TWiV 136: Exit XMRV

June 5, 2011

nude mouseHosts: Vincent Racaniello, Alan Dove, Rich Condit, and Stephen Goff

Retrovirologist Stephen Goff joins Vincent, Rich, and Alan for a discussion of recent papers on the retrovirus XMRV and its association with chronic fatigue syndrome and prostate cancer.

Click the arrow above to play, or right-click to download TWiV #136 (61 MB .mp3, 84 minutes).

Subscribe (free): iTunesRSSemail

Links for this episode:

Weekly Science Picks

Alan – The Demon-Haunted World by Carl Sagan
Rich
– Trends in annual rates of death (pdf)
Stephen – Unexpected inheritance (PLoS Pathogens)
Vincent – Beyond the human eye

Listener Pick of the Week

Raihan  – Bruce Aylward: How we’ll stop polio for good (YouTube)

Send your virology questions and comments to twiv@microbe.tv.

Leave a Reply

Your email address will not be published. Required fields are marked *

434 comments on “TWiV 136: Exit XMRV

  1. Thanks for this one as well Professor.

    A non-scientific couple of questions I am afraid:

     – is it possible to get a transcript of the conversation? Only I do struggle trying to follow who said what, my cognitive abilities are not now what they once were I am afraid.

    – and your title suggested Alan Dove would be in on the conversation, but you didn’t introduce him and I suspect he wasn’t there – could you confirm?

    Many thanks in advance.

  2. Thank you for this TWIV.

    Talking about the Lo/Alter findings, it seemed that no one was aware of the following recent paper:
    http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0019953

    Interestingly, based on phylogenetic analysis, the authors conclude the following:

    “[Lo et al.] argue that the recent sequences (MLV001–MLV006; HQ601957–62) show evidence of viral evolution from an earlier sequence (assumed here to be cfs1 since this was identified in 18/21 sequences). However such evolution would be predicted to show monophylogeny. Our maximum likelihood analysis of these sequences is clearly inconsistent with such a prediction (Figure 2). In particular we see no obvious explanation for a sequence of the modified polytropic cfs1 type evolving into a polytropic sequence like MLV002 or MLV006 (Figure 3), Similarly it seems implausible that MLV001, which shares with 9C a deletion encoding 15 amino acids of matrix (MA), presumably precluding virus replication, could evolve from cfs1. In the absence of evidence for replication competent MLV in the samples reported by Lo and colleagues, we believe that the finding of a population of gag sequences in the reagents, as well as the coincidence of a virtually identical replication incompetent MLV in our study and that of Lo and colleagues, must call into question the biological provenance of these sequences and therefore any conclusions drawn [5] concerning their relationship to CFS.

    • Anonymous Jun 6, 2011

      Not one sequence found to be a mouse virus.

      • That is not what this part is about.

        The authors assert that the sequences that were found by Lo/Alter in their banked samples, are not ancestral to the newly found sequences in the same patients in freshly collected samples.

        • Anonymous Jun 6, 2011

          Based on what evidence though? It is speculation.  In fact the same issue with Paprotka et al.

          • Based on phylogenetic analysis.

          • Anonymous Jun 6, 2011

            That is not evidence that they are not ancestral.  It was specualtion to place them in that order.

          • What would be evidence, in your view, that they are not ancestral?

          • Anonymous Jun 11, 2011

            Other supporting evidence that the virus is infecting the person.  Isolation of the virus, immune response, integration, etc.  Yet, no evidence exists to argue that there was contamination, so the fact that the samples were taken 15 years apart points to them being ancestral. 

          • Those are all experiments that cannot be performed by independent scientists doing independent scientists.

            And this goed right at the core of the problem: you only really view as evidence what the original scientists can produce regarding their original findings, while no new data by independent researchers by doing independent experiments will classify as evidence by your own standard. 

            It’s simply an unprecented standard in the history of science. Oh, and wrong too.

          • Sorry, that is (first sentence)  “performed by independent scientists doing independent experiments”.

          • Anonymous Jun 11, 2011

            Why can they not be performed by independent scientists?  

          • Then just give a single example how an independent scientist doing an independent experiment can produce evidence (according to your defintion of evidence) that these sequences were not ancestral.

            I can give one such example by my own defintion: doing phylogenetic analysis on published sequences that are supposedly ancestral can produce evidence that these sequences were not ancestral.

          • Anonymous Jun 12, 2011

            Replication study.

          • A replication study of Lo et al. could produce evidence that the old sequences derived from Lo et al. were not ancestral to the respective new sequences? It could not. Please stop the obvious trolling.

          • Anonymous Jun 12, 2011

            If the results of a Lo et al. replication study were negative, it would show the sequences were not ancestral.  Think it through.  

          • That would not prove that, Gob. At all.

            Even if the Lo et al. sequences were not in their actual samples but were contaminants, then those sequences that Lo et al. reported could still be ancestral to one another. The sequences being ancestral to one another has nothing to do with those sequences being in the actual samples or not. For checking whether the sequences of Lo et al. are ancestral to one another, you would have to analyze the sequences themselves.You seem profoundly ignorant of basic logical issues.

          • Anonymous Jun 12, 2011

            It would show there was something faulty in the Lo et al. paper and that the virus could not have mutated over time as it was not present in those patients.  However, this is not the case and HGRVs are associated with ME/CFS.   Tell everyone, RRM, how you would use the Lo et al sequences to determine the evolution of the virus?  

          • I have already explained: You could do phylogenetic analysis. Before you scream this is not evidence: you do know this is actually being used in court, for instance to determine if HIV derived from a rapist is ancestral to the HIV derived from the victim? How would you determine if a rapist’s HIV was ancestral to the victim’s HIV? You would do a RE-PLI-CA-TION study?? 
            Also, a replication would not “show” that the original study was faulty. When an exact replication would yield different results you would simply have two supposedly identical investigations with different results. One of these studies’ results would then be wrong, but why would the second one be more likely to be right? You could even argue that the authors of the first study were probably more proficient with using this (their own) methodology. Therefore, there is no way that such an “exact replication” would provide any convincing evidence that the original study was wrong. 

          • Anonymous Jun 12, 2011

            They already have an idea of the evolution of HIV, not HGRVs.  

            You really have no clue what the word replication means.  A negative replication study would point to there being issues with the original study.  The labs would then have to work with each other to work out what and if the other lab actually replicated.  This is how the scientific method works.

          • Then pretty please, with sugar on top,  show me a single example in the history of (retro)virology to prove that this is really how “replication works”. You won’t post such a thing because it exists only in your (and a few others’) imagination.
            I know that science doesn’t work in absolutes. Glad we can at least agree on *something*. However, that statement does not address my post at all.

          • Anonymous Jun 12, 2011

            HIV and HTLV.  

            How will you react when your silly remarks are silenced?

          • I would simply concede the point, Gob.

          • Anonymous Jun 13, 2011

            Thank you for doing so.

          • Anonymous Jun 13, 2011

            Thank you for doing so.

          • Anonymous Jun 11, 2011

            “independent scientists doing independent scientists”   What were you really trying to say?  
            There is no new data that has refuted the positive studies. That is the scientific process at work.  You may wish for HGRVs to not exist, but the data only supports the conclusion that they are infecting people.  I notice that you have suggested no experiment you would like to see to say that the virus detected in the 15 retested patients was not ancestral.  Can you not think of any?

          • Sorry about the typo but I already corrected it, please read below to understand.

          • kipper7 Jun 6, 2011

            Phylogenetic analysis _does_ provide evidence they are not ancestral.

            Btw, which part, if any, of the “scientific method” do you actually understand?

          • Anonymous Jun 6, 2011

            Nice to see another average joe with an opinion and no data.

          • drosha Jun 6, 2011

            at least they are not the obnoxious joe like you.

          • Anonymous Jun 6, 2011

            If you don’t like the data, why are you handing around?

          • drosha Jun 6, 2011

            because I like “handing” around

          • Anonymous Jun 6, 2011

            Then start paying attention.

          • drosha Jun 7, 2011

            unlike you?

          • Anonymous Jun 7, 2011

            Trying finding out about host range.

          • kipper7 Jun 6, 2011

            For an average Joe I’m keeping good company. Let me illustrate:

            Knox K, Carrigan D, Simmons G, Teque F, Zhou Y, Hackett J Jr, Qiu X, Luk KC, Schochetman G, Knox A, Kogelnik AM, Levy JA.

            Paprotka T, Delviks-Frankenberry KA, Cingöz O, Martinez A, Kung HJ, Tepper CG, Hu WS, Fivash MJ Jr, Coffin JM, Pathak VK.

            Alberts B.

            …. & etc.

          • Anonymous Jun 6, 2011

            Simmons has a presentation for an XMRV test in humans this week.    He changes his mind fast.  Last week it was a mouse virus.

          • That’s how scientists work. They devise experiments, run them and report the results.

            Switzer (once the Devil) from the CDC has now published some positive results after negative results, while Singh (now the Devil) has now published some negative results after first having positive results.

            It’s actually the result of being a good scientist, instead of some silly, vast conspiracy to hide the truth (while leaving evidence everywhere for everyone to see).

          • Anonymous Jun 7, 2011

            Thank you for admitting this is retrovirus infecting humans.  Yes, the CDC does have assays that work, but have not been validated for use in blood.

          • Where have I admitted that? I didn’t. I just gave a summary of what Switzer and Singh have reported on. 

            Just like Mikovits has reported on an association between XMRV CFS, the Switzer finding could be false.

          • Anonymous Jun 7, 2011

            Yes, thank you for again saying that HGRVs are associated with ME/CFS and prostate cancer.

          • kipper7 Jun 7, 2011

            Gob,

            RRM clearly doesn’t believe that current evidence suppports an association between “HGRVs” and human disease. When you misrepresent someone’s argument like that it completely undermines the point of discussion.

          • Anonymous Jun 8, 2011

            You may need to read all the answers again and all the data that supports this conclusion.  

          • Lance Jun 8, 2011

            You undermine your own credibility by saying this.

          • Anonymous Jun 8, 2011

            Are you thinking you might now fall out with the others now they have recognise that HGRVs exist?

          • Lance Jun 8, 2011

            How on EARTH can you interpret what RRM said like that? You really only see what you want to see don’t you….

          • Anonymous Jun 10, 2011

            A phylogenetic tree does not invent itself.  In this case they chose to place the two viruses before XMRV.  They did not provide data to support that interpretation and the viruses can also be placed after XMRV.

  3. Anonymous Jun 6, 2011

    I’m afraid it has now been reported that this strain of nude mice, NU/NU and Hsd were not used in the preperation of the 22Rv1 cell line.The authors of the paper have been contacted by the editors of Science and have been asked to deny this fact. We will await their response with interest!  I believe that this matter is to be discussed in the conference in Belgium.  

    The most likely explanation is that these sequences were actually transferred from humans to the mice.  Which should have been proposed in the paper. This has been reinforced by the fact that this mouse strain has been kept isolated from wild mice since its creation. Knox et al. used the PCR assay which had only detected gag sequences in 7% of patients in the Lombardi study when testing Dan Petersons patients and reduced the DNA concentration while doing so and for good measure increased the annealing temperatures.  The likelyhood figures are just plucked out of thin air.  

    Xenotropic Polytropic hybrid MLVs are routinely generated in infected mice.  The use of PCR assays, which have high analytical sensitivity but unknown clinical sensitivity, should be discouraged as negative findings do not prove the absence of target viral sequences.  20 months have been lost because of this fiasco.

  4. A heads up for the prof., if you’re interested. Here’s the reply to Science by Mikovits:

    http://www.wpinstitute.org/news/docs/FinalreplytoScienceWPI.pdf

    • Anonymous Jun 6, 2011

      Proof of what?  That Silverman, Ruscetti, Mikovits, Lombardi, etc.  know how to clinically validate an assay.  Ruled out contamination.  That no mouse viruses have been found.  No XMRV or mouse viruses were found in the 20 samples retested by the CDC.  That Singh only tested 2 Lombardi patients, not 14 like Racaniello mistakely says.  That her assays, never shown capable of detecting a positive, could not detect a known positive and  hence don’t work.  One of which as an EM of a budding virus and serology data to back it up, that can only have come from the SU protein of an MuLV. 

      • I said “for the prof[essor]”, not for the proof.

        If you had listened to the podcast, you would have known that he hadn’t read the Mikovits reply to ScienceMag.

        As for the rest of your post, well….

        – there are no known positives
        – Silverman did contaminate his lab beyond all reasonable doubt
        – testing for mouse contamination would not detect contamination from other sources (e.g. human cell lines).
        – more ‘Lombardi’ patients were tested (VipDx is a ‘Lombardi’ lab)
        -Mikovits herself chose those samples for Singh. They were patients that were reliably positive according to Mikovits. Now, if you are later backtracking on that when the results don’t hold up and say these samples that you yourself have chosen for others to chew on, it isn’t exactly honest, is it?
        -the serology data in blinded testing for the Blood Working Group didn’t back up the earlier results. Also, nobody has independently replicated these serological results either. It must be that not only XMRV is present at the level of detection, but the antibodies are too. How unfortunate.
        -that picture, in isolation (pun intended), doesn’t say much. 
        -Mikovits has said: “we don’t do direct PCR”
         

        • Anonymous Jun 6, 2011

          What a pity, I thought this was all about redefining the meaning of everything.

          There are known positives.  You get them by using multiple assays and having other labs also retest.  Lombardi et al did that. 

          No evidence that Silverman’s Abbott lab was contaminated. 

          No contaminated cell line has been in the Lombardi or Lo labs and Silverman had frozen 22Rv1.

          Again, only for you, Shin et al’s assays cannot detect a known postives.  Proven in their own paper.   You cannot say a patient is not negative if you do not clincally validate an assay.  Singh is also against using a clone as it does not prove clinical validation, but in Shin et al a clone was only used. 

          “”It’s just not sufficient to show that something can detect something in a plasmid template. It’s hard to know if it’s going to detect something in a matrix that’s as complicated as blood or cellular DNA. So I think that’s probably one of the biggest reasons for why people find different results..”  TWiV 94.

          I hope you are not accusing someone of anything nefarious?  Mikovits has never said anything but that those patients were positive.  They are and have never been proven not to be.  But only 2 positives came from Lombardi. 

          The serology from the NCI and WPI matched in the BWG.  You are right about no one attempting a replication of the Lombardi serology.  No one has.  How unfortunate that you don’t have the facts. 

          The EM can only be viewed with the other data.  There you go again trying to single out and ignore data.

          The WPI don’t do direct PCR.  The Cleveland clinic did.

          • Lance Jun 6, 2011

            There are multiple contaminants that show up by a number of different assays. The issue of replication was adequately dealt with in this latest TWiV.

            I have yet to see you acknowledge even the possibility of an alternative view. The fact that Ila Singh’s lab, who discovered the virus and are clearly very good at finding in difficult places couldn’t find it in blood with multiple techniques is very persuasive. For so many virologists to conclude from the current data something so different from you indicates two possibilities. 1) You are wrong. 2) There is a massive conspiracy to cover up human infection with XMRV; which leads to the obvious question – why?

          • Anonymous Jun 6, 2011

            Yet no study has attempted to replicate Lombardi et al. and no evidence exists to support the contamination arguement.  Science is about weighing all the evidence.  That evidence entirely supports a human retrovirus is infecting people with ME/CFS and prostate cancer. 

            The fact that Singh, knowning that and saying that a clone is not enough, then used a clone and did not clinically validate her assays is very persuasive that the results have nothing to say about Lombardi et al. or Lo et al.  So for many virologists to conclude that the current data shows this to be a human retrovirus in ME/CFS and prostate cancer indicates two reasons why you are wrong. 1) you are not familiar with the field.  2) You are not familiar with science.

          • Lance Jun 6, 2011

            That doesn’t really answer the question, does it? The vast majority of scientists who have spoken on this subject have weighed the evidence (as have I) and interpret the data as meaning that XMRV does not infect humans. Many of those who take the opposing view have competing interests (e.g. commercial interests in human testing). Now we all know numbers don’t make everything, but the arguments made against this virus infecting humans are extremely persuasive. This is especially the case of Ila Singh’s lab in whose interest it really is to find XMRV because she has published alot on it’s relationship to prostate cancer which now looks like it might be false. She is therefore in part disproving her own work, showing herself to be truly objective. It would be strange indeed for her to have some kind ulterior motive for not finding XMRV. Should the data change in the future then I’m sure she would revise her view back in a sensible, considered way (as would I). I have yet to see you show any hint of acknowledging any uncertainty or any possibility of another explanation, even hypothetically, which is not very scientific of you.

          • Anonymous Jun 6, 2011

            The vast majority of scientists have said nothing, as this is not their field.  In this field you actually have about a 50% split.  But this is irrelevant, as science is not measured through consensus.  Those who have decided to say it’s contamination, but acutally think differently, could also be said to have competing interests. 

            Now all the data makes a persuasive arguement aginst contamintion and very much for this being a human retrovirus.  

            Singh has of course told journalists that what she is finding is XMRV like, not XMRV.  Maybe it is therefore not so interesting to Singh if she now says what she has found is not XMRV.  But she would be disproving of her own work which said she found XMRV.  Very perculiar. There is also the patent that Singh has for her other assays, not used in the ME/CFS study.  Again, all very perculiar.

          • Lance Jun 6, 2011

            So I presume you believe in the massive conspiracy then. I note once again no sign of acknowledging two sides of this debate. The data at present point overwhelmingly to contamination. (Lack of reproducibility, lack of sequence diversity, identical integration sites etc.)

          • Anonymous Jun 6, 2011

            There is only the complete data, which strongly supports this to be a human retrovirus.  No evidence of contamination.  No sides or consensus.  

            Here is that illuminating quote from Coffin and Stoye on low sequence diversity being against contamination. 

            “Thereare several lines of evidence that transmissionhappened in the outside worldand was not a laboratory contaminant.One is that XMRVs from disparate locationsand from both chronic fatigue syndrome and prostate cancer patients are nearlyidentical: The viral genomes differ by only afew nucleotides, whereas there are hundredsof sequence differences between XMRVs andxenotropic murine leukemia proviruses of laboratorymice. Other evidence includes the presenceof XMRV and high amounts of antibodiesto XMRV and other MLVs in chronic fatiguesyndrome and prostate cancer patients.”identical: The viral genomes differ by only afew nucleotides, whereas there are hundredsof sequence differences between XMRVs andxenotropic murine leukemia proviruses of laboratorymice. Other evidence includes the presenceof XMRV and high amounts of antibodiesto XMRV and other MLVs in chronic fatiguesyndrome and prostate cancer patients.”As no one has attempted to replicated, no one can claim the results cannot be reproduced with that methodology.  As Lo et al found the same virus.  Polytropic sequences of a polytropic xenotropic hybrid, we already have a validation study.  Finally, identical integration sites have been found before in MLV viruses, so it is again, not evidence for contamination.
            are several lines of evidence that transmission
            happened in the outside world
            and was not a laboratory contaminant.
            One is that XMRVs from disparate locations
            and from both chronic fatigue syndrome and
            prostate cancer patients are nearlyidentical: The viral genomes differ by only afew nucleotides, whereas there are hundredsof sequence differences between XMRVs andxenotropic murine leukemia proviruses of laboratorymice. Other evidence includes the presenceof XMRV and high amounts of antibodiesto XMRV and other MLVs in chronic fatiguesyndrome and prostate cancer patients.”
            identical: The viral genomes differ by only a
            few nucleotides, whereas there are hundreds
            of sequence differences between XMRVs and
            xenotropic murine leukemia proviruses of laboratory
            mice. Other evidence includes the presence
            of XMRV and high amounts of antibodies
            to XMRV and other MLVs in chronic fatigue
            syndrome and prostate cancer patients.”

            As no one has attempted to replicated, no one can claim the results cannot be reproduced with that methodology.  As Lo et al found the same virus.  Polytropic sequences of a polytropic xenotropic hybrid, we already have a validation study. 

            Finally, identical integration sites have been found before in MLV viruses, so it is again, not evidence for contamination.

          • Lance Jun 6, 2011

            It is not really your point of view I am critical of, more the degree of conviction with which you hold it. What you say is not supported.

          • Anonymous Jun 6, 2011

            It is support by the data, Mikovits, Hanson, Ruscetti, Lo, Alter, Silverman, Klein, Cabrera, etc, etc.

            It is also supported by Simmons, whose name was on Knox et al, but this week has his name on a new assays for detecting XMRV in humans.

          • Lance Jun 7, 2011

            I find it interesting that:

            1) You’ve never been able to recognise more than one reason for the results of the Mikovits lab (and anyone who has ever done wet experiments knows there’s always more than one potential explanation for a result)

            2) As this debate goes you seem to rely less and less on the published data (which show the opposite of what you say when taken in their entirety) and more and more on quotes and other weak lines of “evidence” such as who might e developing what assay. Who cares about whose name is on what assay? It’s what they show that counts.

          • Anonymous Jun 7, 2011

            However, there is no evidence to support any belief that it is contamination.  It is understandable that you don’t understand the meaning of the word hypothesis.

          • Lance Jun 7, 2011

            Contamination is the most likely of a bunch of unlikely explanations, at present.

            Again you haven’t answered the question or shown any insight into uncertainty.

          • Anonymous Jun 7, 2011

            All the evidence supports that XMRV is one strain of HGRV.  That people with CCC ME/CFS and acute prostate cancer are infected.  Any other interpretation at this time is disingenuous.

          • Lance Jun 7, 2011

            CCC?

            “Acute” prostate cancer??! Can you name any acute malignancy?

          • CCC is Canadian Consensus Criteria.

            Actually, the ad hoc excuse when the first validation studies didn’t replicate the WPI’s findings, was the idea that the CCC were the great and unfallible criteria with all the truly sick people (because WPI did use these criteria) while the Fukuda criteria (that some other studies used) selected lazy fakers.

            Now that we know it’s not the criteria (although somebody needs to page Mikovits).

          • Anonymous Jun 7, 2011

            The idea that the CCC influences results has not been put to the test.  As the other studies have changed multiple other variables, mostly with their assays.  Actually no that’s not true.  Lo et al showed that when you get patients from an expert clinician the positivity rates for HGRVs was 96%.

          • Anonymous Jun 8, 2011

            You are certainly no scientist.

            http://www.ncbi.nlm.nih.gov/pubmed/16773009

          • Anonymous Jun 12, 2011

            This is the same post as that on the top right.

            Systematic evaluation of surgical strategies for acute malignant left-sided colonic obstruction.http://www.ncbi.nlm.nih.gov/pubmed/17968980You are not a doctor or a scientist.

          • The “acute” refers to the (colonic) obstruction.

            I took you four days to come up with that?! 

          • Anonymous Jun 12, 2011

            There are several sources now here for the word acute being used alongside cancer.  Can you not read?

            Here is another, only takes 30sec

            http://www.dh.gov.uk/en/Publicationsandstatistics/Publications/PublicationsPolicyAndGuidance/DH_125727

            Manual for Cancer Services: acute oncology

          • I like how you suddenly reframe the argument to “being used alongside”. Keep it up, Gob, you’re funny!

          • Anonymous Jun 12, 2011

            That is what you did.  

          • Anonymous Jun 8, 2011

            http://www.ncbi.nlm.nih.gov/pubmed/16773009

            You are certainly no scientist.

          • Lance Jun 8, 2011

            And you, my friend, are no physician. The “acute” in that reference refers to the hydrocephalus, not to the malignancy.

          • Anonymous Jun 8, 2011

            Acute myelogeous (or myeloid) leukemia (AML) is a malignancy.  You are no physician either.

          • Lance Jun 8, 2011

            I just mentioned acute leukaemias above.

          • Anonymous Jun 12, 2011

            Systematic evaluation of surgical strategies for acute malignant left-sided colonic obstruction.http://www.ncbi.nlm.nih.gov/pubmed/17968980You are not a doctor or a scientist.

          • Anonymous Jun 8, 2011

            http://www.ncbi.nlm.nih.gov/pubmed/16773009
             
            You are certainly no scientist.

          • Lance Jun 8, 2011

            And “acute prostate cancer??” What is that?

          • I think Gob means “aggressive prostate cancer” here

          • Lance Jun 8, 2011

            Nope, I have not. The question was a bit of a plant, really. Cancer as a disease process is invariably slow with a lag time between the development of a single cancerous cell that eventually develops into a tumour which becomes symptomatic. I have heard of (not to mention seen and managed) acute presentations of cancer but cancer itself is not really described as acute (an exception being the acute leukaemias). This is particularly the case for prostate cancer which is usually very indolent and slow to develop: in fact three quarters of people with prostate cancer die of something else.

          • Anonymous Jun 8, 2011

            I’m more of a plant and I can tell you that the term is used. Then again you only think XMRV was discovered 2 years ago, so you won’t know of the full history and link with acute prostate cancer.

          • What would constitute as evidence, Gob? What experiment could an independent scientist do that would provide you with “evidence” for contamination?

          • Anonymous Jun 7, 2011

            All those the WPI have used.  Which therefore leaves people needing to replicate if they don’t think patients are infected with the XMRV strain of HGRV.  The CDC retested 20 positive samples, they still found no contamination and no virus.  The logical conclusion is that the CDCs assays didn’t work.

          • Lance Jun 7, 2011

            WPI = evidence

            Anything else = not evidence

            A.k.a.

            “agrees with me” = evidence/data

            “does not agree with me” = unscientific/debunked/alien etc*

            * delete as appropriate

          • Anonymous Jun 7, 2011

            Everything is data.  You put that data into a hypothesis.  If the data doesn’t fit, you have to change the hypothesis.  As it stands the data say the virus is there in humans.  If the contamination people had an explanation that made sense, it would also explain the serology results and those of Lo et al, Hanson et al.  It would explain why the CDC could find neither XMRV or contamination in 20 positives.  But they can’t, so they have no hypothesis for contamination.  

          • Lance Jun 8, 2011

            Thanks for a good laugh, gob. Particularly sentence 3! Oh the irony….

          • Anonymous Jun 8, 2011

            The data from the negative papers only states that we don’t know if these assays will work on a wild-type virus, as those assays were not clinically validated.  Thus the hypothesis that HGRVs do exist and are associated with ME/CFS and prostate cancer still fits.

          • Justin Reilly Jun 7, 2011

            There are two sides.  That’s the point (at least for me and almost all pwME).  We do not know for sure whether or not HGRVs are associated with ME.  So ‘they’ should stop saying that we know for sure that the two are unassociated. And they should stop accusing those who point this out of being unscientific.  

            There is a very long and very clear history of NIH, CDC, the UK government and a small cadre of UK psychiatrists waging a war on ME science and patients.  The present shenanigans are more biased attempts to crush valid ME science.

          • Lance Jun 7, 2011

            That seems most unlikely to me. What would be the motivation?

          • Anonymous Jun 9, 2011

            What does it matter what their motivation is.  Their actions have been abominable and it will be stopped. 

          • Anonymous Jun 6, 2011

            Here is where Goff says that all you need is a variation of one base for PCR not to work. 

            “SG: Right. Frank Ruscetti said it’s in plasma, and he was able to recover live replicating virus out of some of these people. So all the signs look good and today still do look good as far as one can see in this paper. But it’s also true that similar studies of even larger numbers of CF patients have been looked at in Europe and elsewhere and they’re not seeing it. So, either there’s geographic issues, there may be strain issues, there might be PCR primers that people are using that don’t work for some strains of virus. One base pair is all you need in the primer to cause you to miss that. ” TWiV 76
            http://forums.phoenixrising.me/content.php?97-Goff-Racaniello-XMRV-CFS-Talk

          • Anonymous Jun 6, 2011

            Here is Goff saying that you only need a variation of one base pair for PCR not to work.  How interesting!

            “SG: Right. Frank Ruscetti said it’s in plasma, and he was able to recover live replicating virus out of some of these people. So all the signs look good and today still do look good as far as one can see in this paper. But it’s also true that similar studies of even larger numbers of CF patients have been looked at in Europe and elsewhere and they’re not seeing it. So, either there’s geographic issues, there may be strain issues, there might be PCR primers that people are using that don’t work for some strains of virus. One base pair is all you need in the primer to cause you to miss that. ”
            http://forums.phoenixrising.me/content.php?97-Goff-Racaniello-XMRV-CFS-Talk

          • Anonymous Jun 6, 2011

            Perhaps Professor Racaniello would, instead of talking about using a different lab (as if this had anything to do with replication), list the number of variables that influence the outcome of a chemical reaction?   

          • And you can tell, as it took them a whopping 60 days to report back on the results and didn’t do any better than an xmrv-infected monkey would do.

            Why didn’t Judy ask the CC to do the BWG work if she had no confidence in her own abilities? It’s all about finding (weak) excuses after the fact….

            Shin et al. did not pove what you say, only in your circular train of thought.And the irony…I am not accusing anyone of being nefarious – you are if you deny this:Light says in response: “The 14 patients who previously tested positive were all selected by Judy.”http://blogs.wsj.com/health/2011/05/04/study-finds-no-link-between-xmrv-and-chronic-fatigue-syndrome/

            Please show me the data that shows the serology matched in the BWG. They didn’t. I gave you a link to the slides that shows the results don’t match multiple times. You are simply misrepresenting a (pretty stupid) quote from Mikovits.

          • Anonymous Jun 6, 2011

            You will find that Mikovits has no influence over who is taking part in the BWG.  Why are you suggesting she has no confidence in her abilities.  She has Alter, Ruscetti, Hanson, Silverman, Lombardi, etc. all backing her up.  Very confident indeed with the data.

            Light does not say 14 positive patients in Lombardi et al.  There were only 2 retested.  Singh’s study shows exactly what I have said.  The Shin et al assays are not clinically validated, and failed to detect a known positive.  Something that Singh has clearly said is not good enough.

            Read the transcript for the FDA meeting last year.  The NCI and WPI results matched.   How data can be stupid is a mystery. 

          • She has influence, as she can invite any scientist to help her in her lab. Also, when she was asked for the BWG, she could at least stated that her results would be tripe because she doesn’t do direct PCR. Luckily, she is allowed to culture the samples in Phase III, although that was NOT AT ALL necessary to get to the whopping 67% result in ScienceMag. Why can’t she just do her magic RT-PCR and solve this thing in days (we should have gotten the Phase III results in Leuven) instead of the 42 day culture?

            However, what’s more important is that Mikovits did not just do single round PCR (as you seem to imply) but used their super duper magical nested RT-PCR on those self-chosen samples and when she failed, then she said:

            “We don’t do direct PCR” <–Actual Mikovits quote after nested RT-PCRI have read the transcipt and the data does not match. In fact, Harvey Alter admits in the end that  he has to "defend" Mikovits (and Lo), because the results of that day were not good. Not good at all, in fact. Alter and Mikovits assert that their results are very reproducible in the lab, outside the setting of the BWG. That is what Mikovits was also referring to in that quote that you seem to be so religiously clinging to. However, it is not the truth.If you have a sheet of the results (and I know youn do), you must know that the resuls do not match. For everyone's reference, here are the results from the BWG (phase II):http://www.cfids.org/webinar/slides-121710.pdfSlide 36 shows how the results of WPI's (PCR) and CNI's antibodies results matched: they don't.Finally, from the transcript you think I do not know about, a quote from Dr Hendry:Finally, in comparing the positive serology results in the Phase IIb from WPI and the positive results from NCI, there was absolutely no concordance. That is, there were no cases where they were positive both by serology and by PCR, which is, I think, another important point.Please not that a single and out of context quote by Judy "we don't do direct PCR" Mikovits about the asserted concordance outside the setting of the BWG does not refute the results that were presented in phase II of the BWG.

          • Anonymous Jun 6, 2011

            Where is the evidence that Mikovits can invite anyone she likes?

            Ruscetti is also a member of the BWG, or did you forget.  He too, along with Silverman and others have refused to retract a paper based on political reasons.  Good for them.  

            Have you looked at the assays in the BWG? The WPIs assays are not PCR alone.  What Mikovits has also said is that they don’t use whole blood.  The rest of your diatribe is, in light of this data, worthless.

            Hendry was referring to the NCI/Ruscetti and CDC labs not having concordance.   The CDC do always seem to struggle some what.

          • The evidence is that it is a free country. She could call you if she wants to. The fact that some grad student apparently mishandled these very important samples implies that the standards for who can and who cannot be involved is not that high, I might add.

            It’s actually very bad to refuse to retract based on political reasons!

            I know you didn’t mean that. You ask everyone for “teh evidunce” but have no problem assuming political reasons based on nothing more than your own preconceived bias. Science asked for a retraction because the methodology in the paper (there is nothing about culturing for 42 days in there) will not result in the reported results. Of course, Science does not like the fact that stupid people have been using:

            “Ohhh, this one is in ScienceMag and it took 6 months to review, it can’t be wrong. Your lousy paper is in PlosOne/Retrovirology. ScienceMag is superior and therefore our results are magically superior.”

            ..as an actual argument. 

            And you must be blind. This is what Hendry LITERALLY stated:

            “Finally, in comparing the positive serology results in the Phase IIb from WPI and the positive results from NCI, there was absolutely no concordance. That is, there were no cases where they were positive both by serology and by PCR, which is, I think, another important point.”

            How is he talking about the CDC instead of WPI? Pleae also note that he finds it “another important point”.

            Finally, please do re-check slide 36 of the following presentation:
            http://www.cfids.org/webinar/slides-121710.pdf

            Not only was there no concordance, in fact NOT ONE sample that Mikovits has designated as being positive by her magical nested RT-PCR, was found to be positive for antibodies by Ruscetti!

            Not one. I would do better than that with my newly developed nested lottery ball assay.

          • Anonymous Jun 6, 2011

            You seem tense.  Well, pressing on.

            You have no evidence and neither does any one else for contamination.  Ruscetti and Silverman disagree with you.  It is a pity we have so many other researchers unable to follow the scientific method.  That’s ok though, as there are plenty more who don’t find it so hard and can’t wait to publish further positive studies.
            Unfortunately for you no one has attempted to replicate one method in Lombardi et al.   Check out the charts on this page.   Hence, no one can claim the results are in doubt.  Replication is a fundamental of the scientific method.  Then again, you being a lay person might not be aware of that unless you passed 9th grade.  They cover replication at that level too.

            Science are now questioning what a mess Coffin has brought them, after being informed of the mouse issue with his study.  Things do have a tendency to backfire.  

            Again, lets be really clear.  Hendry was referring to the CDC results for serology.  You have now provided a slide that is not serology.  Serology is slide 35.  There was concordance with the serology for the NCI and WPI, which is not in the slides.  The slide you gave, number 35, is a combination of NAT and serology results.  

            The interesting question is who was the negative that is now infected?

          • I may be tense but you are dense, my friend… 😉

            Your circular reasoning really boggles the mind. It cannot be that the WPI reported a false positive, no, it must be that the pedigreed negative must now be infected.

            Also, I have provided a slide that includes serology. Please look closer. The “Ab” abbreviation should help you going….

            Again, provide me with an example of a “true replication” in this field. You can’t, which says it al, really…

            And finally, I am really getting tired of “wait for the positive studies that are about to be published”. I am perfectly able and willing to reassess my opinion based on new evidence. People should base their opinion on the *available* scientific evidence. The evidence at this moment is very strongly against XMRV playing any role in CFS (or any other human disease). Sorry.

          • Anonymous Jun 7, 2011

            As you know, there are no details in those slides on the antibody results for the WPI.  But they had concordance with the NCI.  When these new studies do come out will you then stop?

          • Anonymous Jun 7, 2011

            As you know, there are no details in those slides on the antibody results for the WPI..  But they had concordance with the NCI.  When these new studies do come out will you then stop?

          • Of course I would conceed the argument if convincing positive results will prove me wrong. Patients and controls should be handled in exactly the same way from start to finish, starting with collecting. The study should also be ideally blinded by a third party. It shouldn’t be a problem to do this if the association is true,

            There are no detailsfor WPI antibody testing because the WPI did not do antibody testing for this blinded part of the BWG. There was perfect concordance before that, and that is why Mikovits picked those samples: these four were the samples in which the XMRV was supposedly the easiest to detect.

            When you then, and this is important, in blinded testing, completely fail to confirm this, you have to admit you have a huge problem on your hands. At the very least, saying “oh, but we had complete concordance” is then not an argument in your favour, on the contrary.

          • Anonymous Jun 7, 2011

            The WPI did have concordance with the NCIs results.   Again, you are failing to understand that little is known about this virus and how it behaves.  But you are no scientist, so I excuse you for that.  

          • It would indeed be a good start if you would start listening to actual scientists, like the ones in this podcast. Or to the prof. But then you use a very different argument about the authority of scientists. It’s not intellectually honest, Gob.

            The WPI did not have concordance with the NCI. Yes, BEFORE the BWG they had, which is why they chose these samples, which makes the results (and Mikovits’ ridiculous argument) all the weaker. 

            It is exactly my point, so thank you.

          • Anonymous Jun 7, 2011

            The WPI did the same testing at the time of the BWG.  Their serology results had concordance with the NCIs results.

          • Just like Lo et al. was blinded, right?

          • Anonymous Jun 7, 2011

            Only some labs and phases had blinded samples in the BWG so far.

          • Lance Jun 7, 2011

            Nobody’s a scientist according to your view. In fact, down is probably up.

          • Anonymous Jun 7, 2011

            Ruscetti, Mikovits, Silverman, Lo, Alter, Hanson, Cabrera, are scientists. 

          • Lance Jun 8, 2011

            Just as I thought you would say.

            Agrees with gob = scientist

            Disagrees with gob = not scientist

          • Anonymous Jun 8, 2011

            The latter have all chosen to follow the scientific method.  

      • kipper7 Jun 6, 2011

        Gob: let’s try this one more time — there are _no known positives_.

        • Anonymous Jun 6, 2011

          Evaluation of diagnostic tests for infectious diseases: general principles

          “Non-commercial or ‘in-house’ reference standards are legitimate only if they have been adequately validated. Sometimes, composite reference standards might have to be used in the absence of a single suitable reference standard. Results from two or more assays can be combined to produce a composite reference standard6.”

          “External validation can be performed by sending all positive specimens and a proportion of the negative specimens to another laboratory for testing.”

          • Your quote, no matter how well found by the Google-PhD’s at the forums, does say NOTHING AT ALL about assays when validating a finding itself. With the quote you provide, the finding itself was already validated.  When validating a finding, you CANNOT use the perceived results of the finding you are trying to validate. Ever.

            Show me a relevant quote that proves I am wrong, Gob. You cannot find such a quote from the literature, and you have just proved that you have tried to look for it. 

            And Lombardi used “split samples” for validation. At least, that is the latest that they are saying. It’s not in the Science paper, but whatever. Seeing how they admit that they had to run most sample multiple times to get positive results, it seems like a very weak validation method. “Oh this sample is positive one time out of four, and therefore it is a positive reference”. I hope she isn’t serious about that….

          • Anonymous Jun 7, 2011

            That quote is from the WHO.  That is how you validate an assay.  You may dislike it, but those assays have been validated.  This is how it has always been done.  I’m am not at all suprised that you are ignorant of this fact, but know you have not the necessary level to grasp it further. 

            What are you now referring to about split samples?  The WPI tested 101.  The CC 11.  The NCI 20.  Since then the NCI have run plenty more and like the WPI have no trouble detecting HGRVs with their validated assays.  Again, all samples were handled the same, or are you accusing Frank Ruscetti of lying? 

          • kipper7 Jun 7, 2011

            “You may dislike it, but those assays have been validated.”

            These being the same assays that declare Dr. Mary Schweitzer both XMRV +ve and XMRV -ve?

            Flip a coin, Gob; it’s cheaper and just as accurate.

          • Flipping a coin is even more accurate than WPI’s Phase IIb results. They had 3 out of 8 positives psoitive, and 1 out of 2 negatives positive.

            (Bog can explain that though: the pedigreed negative got infected)

          • Anonymous Jun 7, 2011

            The conclusion of the BWG after Phase II was that the results were too small to be conclusive of anything.  Hence Phase III and IV.

          • I agree the sample size was too small to draw definite conclusion, but still, the WPI’s super duper magical RT-PCR assay predicted the know positives worse than flipping a coin on average would do. It’s a fact.

          • Anonymous Jun 8, 2011

            They concluded also that there could well be a something very simple that they failed to do in that phase.

          • Anonymous Jun 7, 2011

            They use two tests to confirm HIV and some patients get tested by those two more than once.  Do you know why?

          • That is not in the context of validating a finding itself, Gob. If you read back, I have never asserted that you can never use known positives. You cannot use positive of the study tou’re trying to validate. It’s an essential difference but, as a great scientist, you must know that.

            Show me a study, Gob. One single study in the history of virology, where they used the perceived positives of a study they were trying to validate. It shouldn’t be hard, like it wasn’t hard last month.

            You have just proved that you have searched. And thus, your unability to come up with one such study is telling.

          • Anonymous Jun 10, 2011

            HIV.

          • Come one Gob, you can do better than that. That is not a study. 

            Of all the validation studies, surely you must find such a single study, if it’s ‘the only way to go in science’ and ‘the regulators wouldn’t approve anything else’?

          • Anonymous Jun 10, 2011

            Now that you realise what happened with HIV you are changing your requirements.  

          • No, I am not. 

            I have been asking for such a study (which sould be really easy to find) for more than a month and you have failed to find one. Moreover, I am perferctly willing to substantiate this assertion with evidence, as you are a) unwilling or b) unable to. Do you really want to discuss this, backing it up with data, or do you only want the last word?

          • Anonymous Jun 11, 2011

            How can you not know which were the first positive and second positive study with HIV?  

          • How can you not know that the Gallo study did not calibrate its assays to the known positives of De Montagnier study in order to confirm them?

            Come on, Gob, you can do better than that.

          • Anonymous Jun 11, 2011

            Try again.

            Or are you claiming that the press conference called by the HHS to declare the discovery of HIV was built upon one study? A study that had not even been published.

  5. Anonymous Jun 6, 2011

    Replication is being redefined.   No one has tried to replicate Lombardi et al.

    • You missed a few:

      Handling (collecting, storing, processing) of all samples in the same way:

      Lombardi: No
      Lo/Alter: No

      Blinded testing:

      Lombardi: Yes (although not reported in the original paper and not corrected in Mikovits’ reply to Patrick Moore’s criticism at F1000)
      Lo/Alter: No

      • Anonymous Jun 6, 2011

        Lo et al was blinded.  Lombardi et al handled all the samples the same.  Have a read of the response from Ruscetti and Mikovits.  Lombardi et al had to be blinded for the NCI to take part and for science to publish it.

        • Lo et al was not blinded and you know that:

          “We did not specifically blind and mix the two sample groups (CFS and blood donors).”
          H.J. Alter, MD, MACP and S‐C Lo, MD, PhD
          http://www.cfids.org/cfidslink/2010/090104.pdf

          Lombardi did not collect patient samples at the same time as the control samples. Therfore, the patient samples were not handled the same way as control samples from start to finish.

          • Anonymous Jun 6, 2011

            Lo et al was blinded.  Ask Alter and Lo.

            Samples were handled the same way.

          • As the samples used were banked samples, they couldn’t have been handled in the same way.

            Alter/Lo et al was not blinded. I’ve provided a literal quote from Alter/Lo. In fact, in the comments section of this blog, you have conceded this:
            http://www.virology.ws/2011/03/02/authenticity-of-xmrv-integration-sites/

            I suggest you check with Alter/Lo.

          • Anonymous Jun 7, 2011

            Handled the same.  

            “All samples were blinded, as mandated by the NCI and WPI institutional review board approvals. All experimental proce- dures were done by the same personnel, in the same physical laboratory space, under identical protocols.”

          • Do you concede the fact that Alter/Lo was not blinded? 

            Also, it is a known fact that Lombardi et al. used banked patients samples. Therefore, although “handling” in the lab might have been the same, the samples HAVE NOT been handled in the same way from start (collecting) to finish (testing). Sorry.

          • Anonymous Jun 7, 2011

            It was blinded.  The samples were all handled the same, as they had the same collection procdure to ensure any viruses were not destroyed. 

          • You have just accused Harvey “we didn’t blind and mix” Alter of being a liar.

            Do you have a source for this assertion or are you lying? Please Gob, show me wrong and I will respectfully concede the argument.

          • Anonymous Jun 7, 2011

            Check again.

          • Lance Jun 7, 2011

            You are blinded!

        • kipper7 Jun 7, 2011

          Lo et al was *not* blinded.

          Read the source, Luke, read the source: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2936598/?tool=pubmed

          Search for the word “blinded”.

          Ain’t there, is it?

  6. Anonymous Jun 6, 2011

    XMRV is not xenotropic.  It is a polytropic and xenotropic hybrid.  So how can two xenotropic viruses have created it as Goff implies?   If they are PreXMRV’s they could also have replicated in mice.  Besides they could also be PostXMRV’s. Which again puts further enormous holes in the Paprotka paper.  How has Goff forgotten that XMRV is a hybrid?

    • Lance Jun 6, 2011

      However XMRV itself has a high mutation rate (shown in cell culture) so you can’t really use that argument.

      • Anonymous Jun 6, 2011

        In which cells?  Those treated with testosterone, which XMRV is responsive to.

        • Lance Jun 7, 2011

          Doesn’t matter. It’s the viral enzyme that lacks fidelity .

          • Anonymous Jun 7, 2011

            What evidence do you believe supports that?

          • Lance Jun 7, 2011

            Nothing that would convince you!

            The sequence diversity in the Towers paper, for example.

          • Anonymous Jun 7, 2011

            Which towers paper?  There are two that have been debunked.

          • Bwahahaha..they’re “debunked” at the forums, Gob, not in the real world. 
            You are not now at the forums if you hadn’t noticed.

          • Anonymous Jun 7, 2011

            Didn’t expect you to name them, as you don’t know the research.

          • Of course I know what you mean. The first is the most extensive of those “Christmas Garbage” papers, and the second one was where they showed identical integration sites were submitted to genbank from two different XMRV studies from the same lab.

            I know I laughed my ass of in the comment section of Retrovirology of that last study. Please check comment 58 of the following blogpost to see I sometimes understand things better than the very best scientists in the world: http://scienceblogs.com/erv/2011/02/xmrv_lab_contaminant.php

            Oh, and the Garson et al. paper is not at all debunked with those two 198x papers. Not at all, actually. For one of several reasons, please read the following Dusty Miller comment carefully: http://www.retrovirology.com/content/8/1/13/comments#473692

            Another reason is that Garson et al. does not (at all) hinge on the assertion that there are no identical integration sites. That is a straw man that has not been corrected at the forums. Which is why you shouldn’t “debate” science in front of the choir, sir.

          • Anonymous Jun 7, 2011

            MLV viruses are known to integrate into hot spots and do integrate into the same nucleotide position.  There is no argument.  Those are the facts.  What other data was there in that paper?

          • It’s really funny that you found out that these viruses integrate into hot spots as that is actually in the paper (see the discussion section)

            Integration in the same nucleotide position has however never occured in two different, independent (), the finding of one (or two) integrations at the same nucleotide position in the history of virology, would in no way negate or “debunk” the finding of Garson et al. It would certainly still remain nigh impossible that a lab then sequenced like patient 14 integrations sites, and found not just one duplication with a previous experiment, but two. 

            Yeah, great debunking, team.

          • Anonymous Jun 7, 2011

            But the paper is ignorant of the fact that MLVs integrate into the same nucleotide position as shown in more than one paper.  Which renders the entire issue irrelevant to possible contamination.

          • No, it doesn’t render the issue irrelevant. Please read my post above to understand why. 

            You are now resorting to non sequiturs. My post is entirely relevant and simply answering “something” will not change that one bit. Please stick to the arguments.

            Oh, and Lo et al. was not blinded. 

          • Anonymous Jun 8, 2011

            That’s right there was nothing else in Garson et al.  Good idea too, the Garson paper should now be retracted.  

          • Anonymous Jun 7, 2011

            What evidence do you believe supports that?

  7. Anonymous Jun 6, 2011

    It’s very amusing that one of the authors of the negative paper from Science last week.  The paper Knox et al.  Is this week presenting a paper for an assay for detecting XMRV in humans.  This assays has no evidence for use in blood, where the virus is known to be at a low level.  But it is clear they don’t actually believe XMRV is a contaminant this week.  This assay was also not used in Knox et al.

    http://www.retrovirology.com/content/pdf/1742-4690-8-s1-a220.pdf

    “Conclusions

    We developed an automated high throughput real-time

    RT-PCR assay (with internal control) to detect XMRV.”

    • Anonymous Jun 6, 2011

      This paper is another using a different technique  (Lombardi et al used 4, Lo used another, Singh in prostate cancer another) to find XMRV in humans.  Yep, it’s not a contaminent. 

  8. Anonymous Jun 6, 2011

    So, the XMRV association with ME/cfs is over and was all due to contamination.   Really ?
    Lets wait and see.

  9. Regarding the statement that the panic is over:

    What you have seen so far is NOTHING compared to the yelling and panic, all justified, that you will hear from the patient community if the association to HGRVs is buried without appropriate scientific rigour and honesty, neither of which we have seen to date. All we have seen is author after author of non-replication attempts claiming to have replicated the experiment and failed. Stop lying. We are not stupid.

    This statement showed a complete failure to grasp the essence of the problem: a VERY serious disease that destroys millions of lives has gone completely untreated for over 30 years. How does burying a connection to a retrovirus solve that? It does not. The disease is still out there. There is still evidence that it is infectious. Only now you are even farther away than before from finding the cause and providing a solution.

    No, burying this association will not cause the yelling to fade away, far from it.

    • Do you think the BWG and Lipkin studies with not be enough then? Will you and others still demand ‘replication’ even when nobody seems able to complete one?

      BTW have you actually listened to the above discussion with Prof Racaniello? Just interested.

      • I, and most patients will accept a study that can not be picked apart for the numerous reasons the experiment could have failed. Cohort definition matters – you actually need to be looking at patients that have the disease you are supposed to be studying. Several of the papers so far fail on that point alone. Of those that are left, they have messed with multiple variables for a very fragile tool – PCR simply does not work if you switch around the variables. And noone has tried to used the same antibody tests, nor provided an explanation for why the Lombardi patients were antibody positive.

        So, to answer your question – no, we will not accept Lipkin’s study just because it is Lipkin, just as we do not accept Singh’s study just because it is Singh’s or anyone else’s study simply because of who they are.

        We will accept a study that is done right.

        Doing it right means keeping the variables the same. It means testing more than once for the same patient since the virus tends to be low copy, slow replicating and is often latent and not active in the blood. Anything less is not replication and is meaningless when you are talking about a new virus for which there is no standard test. We would also like to see lymph and epithelial tissues tested. Given what is known about this virus so far, this would make sense.

        Did I listen? I responded to the quote, specifically. Goff said “the crisis is over”. In what world? We are still sick and still have no answers. Doesn’t seem over to me at all. That comment spoke to the complete arrogance of the scientific community who seem to believe this is about XMRV or returning to the status quo. Well it is not. We will not let up. We need answers. I am only 33 and my career has been killed before it even started. I can’t have kids because of this disease. I can’t live. Unlike many patients I am still capable of doing exercise, and I do, but I assure you that it does absolutely nothing to help me get healthy and back to work. So do you think I am going to just crawl away and shut up if XMRV is pushed aside? No way in hell. I want to have a life. Some virus is making my lymph nodes puff up all over my neck. Some immune process is causing me to react in unpleasant ways to a long list of common foods, chemicals and activities I used to have no problem with.

        What I hear from the virology community is this kind of smug tone of “good, maybe now the patients will leave us alone”. No, we will not. Don’t you dare kill this research path without opening another one that has at least as strong a chance of getting us out of this hell.

  10. Guest Jun 6, 2011

    Human infection or lab artifact: will the real XMRV please stand up?

    Robert H Silverman Department of Cancer Biology, Lerner Research Institute, Cleveland Clinic, Cleveland, Ohio, USA

    http://www.retrovirology.com/content/8/S1/A241

    Xenotropic murine leukemia virus-related virus (XMRV) was first
    identified in 2005 in a study of human prostate cancer patients with
    genetic variants of the antiviral enzyme, RNase L. Subsequent
    investigations in North America, Europe and Asia have either observed or
    failed to detect XMRV in patients [prostate cancer, chronic fatigue
    syndrome-myalgic encephalomyelitis (CFS-ME), immunosuppressed with
    respiratory tract infections] or normal, healthy control individuals.
    Among the confounding factors are the potential for lab contamination
    with similar or identical viruses or viral sequences originating in
    mice. In some studies, relatively contamination-resistant methods (e.g.
    IHC, FISH, and antibody detection) suggest that either XMRV or a similar type of virus is present in some patients. Evidence for and against genuine infections of humans with this intriguing virus (and/or related viruses) will be discussed.

     

  11. Guest Jun 6, 2011

    XMRV IS NOT OVER!

    Restricted infection of xenotropic murine leukemia virus-related virus in human lymphoid tissue

    http://www.retrovirology.com/content…-8-s1-a208.pdf

    Absence of xenotropic murine leukaemia virus-related virus in Danish patients with multiple sclerosis

    http://www.retrovirology.com/content…-8-s1-a213.pdf

    Heme oxygenase-1 activation inhibits XMRV pathogenesis and carcinogenesis in prostate cancer cells

    http://www.retrovirology.com/content…-8-s1-a218.pdf

    XMRV replicates preferentially in mucosal sites in vivo: Relevance to XMRV transmission?

    http://www.retrovirology.com/content…-8-s1-a219.pdf

    A prototype RT-PCR assay for detection of XMRV in multiple human sample types

    http://www.retrovirology.com/content…-8-s1-a220.pdf

    Immune correlates of XMRV infection (Lombardi, Mikovits, etc)

    http://www.retrovirology.com/content…-8-s1-a221.pdf

    Prevalence of XMRV in blood donors, HTLV and HIV cohorts

    http://www.retrovirology.com/content…-8-s1-a222.pdf

    The effects of XMRV gene expression on the mouse prostate

    http://www.retrovirology.com/content…-8-s1-a223.pdf

    XMRV: usage of receptors and potential co-receptors

    http://www.retrovirology.com/content…-8-s1-a224.pdf

    Cell line tropism and replication of XMRV

    http://www.retrovirology.com/content…-8-s1-a225.pdf

    Structure of the xenotropic murine leukaemia virus-related virus matrix protein

    http://www.retrovirology.com/content…-8-s1-a227.pdf

    Development of XMRV producing B Cell lines from lymphomas from patients
    with Chronic Fatigue Syndrome (Ruscetti, Mikovits and others)

    http://www.retrovirology.com/content…-8-s1-a230.pdf

    Multi-laboratory evaluations of XMRV nucleic acid (BWG report)

    http://www.retrovirology.com/content…-8-s1-a231.pdf

    Serologic and PCR testing of persons with chronic fatigue syndrome in
    the United States shows no association with xenotropic or polytropic
    murine leukemia virus-related virus

    http://www.retrovirology.com/content…-8-s1-a232.pdf

    XMRV infection in human diseases

    Otto Erlwein , Mark J Robinson, Steve Kaye, Myra O McClure, Marjorie M
    Walker, Anup Patel, Wun-Jae Kim, Mongkol Uiprasertkul, Ganesh
    Gopalakrishnan, Takahiro Kimura and Kikkeri Naresh

    http://www.retrovirology.com/content/8/S1/A238

    Murine leukemia viruses (MuLV) and Xenotropic MuLV-related viruses exhibit inter-tropic complex recombination patterns

    Mattia CF Prosperi , William M Switzer, Walid Heneine and Marco Salemi

    http://www.retrovirology.com/content/8/S1/A235

    Detection of MLV-like gag sequences in blood samples from a New York state CFS cohort

    Maureen R Hanson , Li L Lee, Lin Lin, David E Bell, David Ruppert and David S Bell

    http://www.retrovirology.com/content/8/S1/A234

    Human infection or lab artifact: will the real XMRV please stand up?

    Robert H Silverman

    http://www.retrovirology.com/content/8/S1/A241

    • Anonymous Jun 6, 2011

      Don’t forget the paper Retrovirology have decided not to post a the last minute.  XMRV in blood donors.

  12. Guest Jun 6, 2011

    Murine leukemia viruses (MuLV) and Xenotropic MuLV-related viruses exhibit inter-tropic complex recombination patterns.

    Mattia C F Prosperi1 , William M Switzer2, Walid Heneine2 and Marco Salemi1

    Background
    Murine leukemia viruses (MuLV) are classified into
    three groups by host tropism correlating with viral receptor sequences
    present in the surface protein of env. Ecotropic MuLV are found only in
    mice, xenotropic replicate in non-mouse cells, and polytropic in mouse
    and non-mouse hosts. Xenotropic MuLV-related viruses (XMRV) and
    polytropic MuLV have been found in humans and reported in different
    diseases, including prostate cancer and chronic fatigue syndrome.
    Classification of MuLV tropism is typically done using small portions of
    gag/pol, however, this may be complicated by viral recombination.
    Methods and results
    Eight
    eco/poly/xenotropic MulV complete genomes were selected from GenBank,
    plus an XMRV sequence. The dataset showed strong phylogenetic signal. By
    tropism-group analysis using SimPlot software, XMRV was detected as a
    mosaic recombinant form of all three groups. Using more sensitive
    analyses, we found evidence of inter-tropic recombination, especially
    outside of env. Different procedures for recombination analysis
    (SimPlot/TOPALi2), applied to the whole dataset independently from the
    tropism, inferred discordant break-points.
    Conclusions
    Given
    the evidence of inter-tropic recombination in MuLV, detection and
    classification of recombination in XMRV using different MuLV tropism
    prototypes should be interpreted with caution. Despite using a small
    dataset, a strong phylogenetic signal in the alignments and highly
    resolved phylogenies inferred both by full-length and sliding-window
    approaches, different recombination programs reported conflicting
    results. These results suggest that identification of parental strains
    of the potential recombinants is difficult and that recombination in the
    highly genetically related MuLV have been occurring for some time.

  13. Guest Jun 6, 2011

    interesting to hear dr Goth about xmrv, he really is a good scientist!

    it would be really great if you could hear from one of the pro xmrv group. Perhaps you could have them on your show?

    Dr Frank Ruscetti – is pro XMRV http://ccr.cancer.gov/staff/st

    Dr Sandra Ruscetti – is pro XMRV http://ccr.cancer.gov/staff/st

    Robert Silverman – is pro XMRV http://www.lerner.ccf.org/canc

    I
    think its very important you have one of these scientists on your show,
    so we can hear what work they are doing and what there thoughts are.

    • Anonymous Jun 6, 2011

      You could also try Hanson, Cabrera, Lo, Alter, etc.

  14. Anonymous Jun 6, 2011

    “There are several lines of evidence that transmission happened in the outside world and was not a laboratory contaminant.  One is that XMRVs from disparate locations and from both chronic fatigue syndrome and prostate cancer patients are nearly identical: The viral genomes differ by only a few nucleotides, whereas there are hundreds of sequence differences between XMRVs and xenotropic murine leukemia proviruses of laboratory mice.  Other evidence includes the presence of XMRV and high amounts of antibodies to XMRV and other MLVs in chronic fatigue syndrome and prostate cancer patients.”Coffin & Stoye, 2009A New Virus for Old Diseases?Editorial that accompanied Lombardi et al. in Science.A New Virus for Old Diseases?Editorial that accompanied Lombardi et al. in Science.Coffin & Stoye, 2009A New Virus for Old Diseases?Editorial that accompanied Lombardi et al. in Science.A New Virus for Old Diseases?Editorial that accompanied Lombardi et al. in Science.

  15. Sick and tired Jun 6, 2011

    It is interesting that Dr Goff who commented on the first macaque study, which showed virus injected into them caused the virus to “migrate” in certain area of the body notably prostate and cervical area. Monkeys don’t lie! 
    Patients with ME/CFS I am sure would be more than willing to participate in a blinded randomized clinical trial involving Raltegravir vs placebo. I would be the first one to volunteer. You can count the clinical trials in single digits over the last 30 years. 

    The Whittemore-Peterson is no fraud at all. That was a pretty insulting comment. They are the first group that really care about neuro-immune illnesses, and that will go to the bottom of things. Unfortunately they are spending lots of time on proving the past papers when they could really move forward. WPI is not going to go away because patients are supporting them, and they have built a network of scientists and physicians to understand the science. That is a good thing. In contrast there seem to be a coalition of people including Towers, Stoye, Coffin, McClure, Wessley, Switzer and other that wants WPI to just go away, without giving Dr Mikovits the chance (other than a brief 20 minutes at the State of Knowledge meeting in April) to speak up. 

    Towards the end one of you mentioned 30 years of AIDS research and the successes that were achieved. It is bitter sweet for the patients with ME/CFS who were part of the 1984 epidemics, were dismissed as hysterical by the CDC. While AIDS got awarded billions and billions in research funding, ME/CFS got just about none, and 30 years later, ME/CFS patients are still sick and unable to participate in family, social and work life. So thank you for reminding of the 30 years of funding AIDS research. 

    It’s a pretty sad state of affair. 30 years is a long long time in a person’s life. You could be next. 

    • Lance Jun 7, 2011

      The macaque study doesn’t unfortunately provide any validation for human disease. The fact that you can inject loads of virus into a macaque and then recover some virus doesn’t really tell you anything other than you injected a macaque with loads of virus. The macaques didn’t get sick at all. Nor have there been any experiments showing how the macaques might subsequently become infectious. Of course the macaques developed antibody to XMRV, but then they would do the same thing if you just injected them with bovine serum albumin, or keyhole limpet haemocyanin, or any other model antigen.

      An RCT of raltegravir isn’t justified at present. Also an RCT of a single drug would likely never be justified. If, for a minute, we assume this virus really is infecting humans (not supported by the evidence at present) then using a single drug is likely to lead to resistance rapidly. The in vitro data suggest that the XMRV polymerase is similarly error prone as the HIV polymerase, and in HIV a single amino acid change in the integrase is enough to confer resistance to raltegravir rendering the drug useless. We have leaned from HIV not to treat highly error prone viral infections with single drugs and multiple drugs increases the risk of side effects. Moreover, although raltegravir was very well tolerated in the HIV trials (the “BENCHMRK” trials) it has since been associated with depression in some patients which would not be a good thing for someone with CFS. Whilst the risk of this is low, it should be balanced against the (currently poor) evidence that XMRV is a human pathogen, or even infects humans.

      I agree that WPI have not committed fraud. They are simply mistaken.

      • Anonymous Jun 7, 2011

        Assays therefore optimised to macaque’s need to be validated for use in humans.  The XMRV assay from Simmons and others that appears as an abstract in Retrovirology therefore needs to clinically validated.  Even if it is identifying positives now, it won’t be picking up anything like the numbers that are infected.  HIV is the same when assessed in monkeys and all assays for HIV must be clinically validated.

  16. Here are the results of Phase IIb of the Blood Working Group for everyone to see.

    Not one matching positive result, but still “total concordance” between WPI and NCI according to Gob, based on an out of context quote by Mikovits. 

    In fact, these results are worse than mere chance would predict. This actually implies that being XMRV positive is associated with being XMRV negative! 

    All using validated (cough, according to Gob) tests, like WPI’s magical nested RT-PCR. I am impressed by these watertight results!

    • Anonymous Jun 6, 2011

      Here is a paper looking at blood donors.  

      http://www.retrovirology.com/content/pdf/1742-4690-8-s1-a222.pdf

      “Conclusions

      XMRV seroprevalence ranged from 0 – 0.6% in US blood donors, HIV-1 infected and HTLV uninfected subjects. Notably, 4.1% of Japanese HTLV-I infected individuals were p15E reactive. Inspection of sequence homology between HTLV and XMRV revealed a high level of conservation within the immunodominant region of HTLV gp21 suggesting increased seroreactivity is due to crossreactive
      antibodies.”

      • Guest Jun 7, 2011

        ‘Please, RRM stop messing about. This is very serious’…such a retarded statement. Note: No HIV-1 infective specimens were reactive. 

        Erv

      • Lance Jun 7, 2011

        That abstract is a great example of why you don’t use antibody tests to search for novel infectious agents. With any antibody assay getting the negatives to be negative is the hardest thing of all. Antibody tests are sensitive but lack specificity (just put “Flavivirus” into pubmed for example). The macaque study showed a weakly reactive false positive in one their assays too.

        • Anonymous Jun 7, 2011

          The Lombardi et al. serology assay was specific to an MLV virus, not mouse ERVs or human ERVs.   

        • Anonymous Jun 7, 2011

          The Lombardi et al. serology assay was specific to an MLV virus, not mouse ERVs or human ERVs.

    • Anonymous Jun 6, 2011

      Phase IIb, where the CDC switched assays after detecting the virus.  Where the person used as the negative control was then found to be infected.  Where the WPI and NCI had concordance with their serology assays.  Where tiny misteps can make all samples negative if the person taking the blood or preparing the blood does not follow instruction. Where the WPI were asked to use whole blood, when they don’t have an assay for whole blood.

      • kipper7 Jun 6, 2011

        “Where the person used as the negative control was then found to be infected.”

        So Dr. Mikovits’s pedigreed negative is, in fact, positive? And, consequently, you want the VIPdx test  yanked from the market because you believe it incapable of producing a reliable diagnosis?

        For once, Gob, I find myself agreeing with you 😉

        • Anonymous Jun 6, 2011

          This close contact is now positive.

          • kipper7 Jun 6, 2011

            So the “pedigreed negative” was infected during phase II of the BWG? What was the vector of transmission?

          • Anonymous Jun 6, 2011

            The person the sample is from is now infected.  

          • kipper7 Jun 6, 2011

            “The person the sample is from is now infected.”

            Infected _during_ phase II of the BWG — kinda scary, huh? Guess we’re all at risk.

            But at least we agree the VIPdx assay should be pulled from the market.

          • Anonymous Jun 6, 2011

            On what basis?  There is no regulatory reason to do so.  Especially now we have all these people presenting this week on new assays and how they can find HGRVs.

          • kipper7 Jun 6, 2011

            Because the WPI/VIPdx test will say you are both infected and not infected.

            From Dr Mary Schweitzer’s blog (http://slightlyalive.blogspot.com/)

            “There were problems. I tested positive in that original 2009 study – they found XMRV by serum and antibodies. But when Dr. Peterson sent a sample to VIP labs early in 2010, it came back negative.”

            I wouldn’t bet the farm on that test, Gob. Would you?

          • Anonymous Jun 6, 2011

            How much research has gone into uncovering this virus?  Why do you image they all know how it behaves?  It is actually not unexpected that someone now on medication would have a different result before they started taking it.  There is also the life cycle of the virus to consider, which you haven’t.

            How many variables are there is PCR?  You should be able to name them to.  

          • kipper7 Jun 6, 2011

            “It is actually not unexpected that someone now on medication would have a
            different result before they started taking it.  There is also the life
            cycle of the virus to consider, which you haven’t.

            How many variables are there is PCR?  You should be able to name them to.”

            Well it was clearly a surprise to the WPI/VPIdx, the group *previously* charging members of the public several hundred dollars for a test that was no more reliable than tossing a coin.

            I see, as of today, 6 June, they have stopped accepting blood for testing.

            Any comments, Gob, on the test that was so good … so good that WPI/VIPdx chose to withdraw it?

          • Anonymous Jun 6, 2011

            It is one of the few assays that is clinically validated, unlike every negative paper out there.  Look closer to find out why they are not testing.  

          • kipper7 Jun 6, 2011

            Gob: let’s start again.

            _There are no clinically validated assays._

            (See above: same test providing different results for the same person.)

            But, if a reliable test did exist and your company owned the rights to it, why would you voluntarily stop testing people and _change the name of your company_?

          • Anonymous Jun 6, 2011

            No clinically validated assays!!!  Only the ones proven capable of finding a positive and optimised for humans.

          • kipper7 Jun 6, 2011

            “Only the ones proven capable of finding a positive and optimised for humans”

            And, damnit, they just gone withdrawn that self-same test!

          • Anonymous Jun 6, 2011

            Not really true is it. What could you be missing?

          • Uh, Gob, this is not proven at all. In fact, that is why there are certain studies underway to check this out. You know about the Lipkin study, don’t you? 

            What is its purpose if the WPI’s (and VipDx’s) assays are proven to work?

          • Anonymous Jun 6, 2011

            You clinically validate by testing positives.  That is the only possible way to know if an assay works.  Ila Singh has agrees with this.  

          • That is why I immediately criticized Ila Singh when she (seemed to) propose(d) that. See here: 
            http://blogs.wsj.com/health/2010/11/04/whats-next-for-x-as-in-xmrv/tab/comments/

            Luckily, people get smarter over time and Ila Singh is no exception. 

            You cannot use the perceived results of the study you’re trying to validate. Please show me an example if you disagree. I am perfectly willing yo reassess my opinion.

          • Anonymous Jun 6, 2011

            Yes you can, with a new virus.

          • kipper7 Jun 6, 2011

            “Luckily, people get smarter over time”

            This cannot be a universal truth, RRM, as I can think of at least one exception 😉

          • There is always one exception to the rule… 😉

          • Anonymous Jun 6, 2011

            Have another look at the website.  You missed something.

          • You’re waffling Gob.

            First you said it was a sequencing error that made the very well pedigreed negative go positive in blinded testing. Now the well pedigreed negative (using Mikovits’ magical RT-PCR, her heroic 42 days of culture, and Ruscetti’s infallible antibody test) has suddenly turned positive?

            Now we have to find another healthy control to pedigree? How unlucky for the truthers. What are the odds of this happening in reality?

            You know, I think Simon Wessely and Bill Reeves broke into the poor person’s house and injected the pedigreed negative with XMRV to hold up the BWG. It makes perfect sense!

          • Anonymous Jun 6, 2011

            It is dependant on which section of the trial you are meaning.  Your are right about needing a new negative.  All the labs finding this virus, get about 50% positivity from contacts.

          • Then why use contacts as pedigreed negatives in a multi-lab, four-phase trial that will take more tha a year? 

            I take it you must not think very highly of the persons who chose these pedigreed negatives?

          • Anonymous Jun 6, 2011

            Who would you think would be negative?

          • I would choose non-contact controls. Preferably some inuit. But I would never choose a contact control as a pedigreed negative for a multi-phase study – as I am not crazy.

            Who would you think would be negative?

          • kipper7 Jun 6, 2011

            *Everybody* is negative, Gob. Did you even listen to the podcast?

          • Anonymous Jun 6, 2011

            How will you take it when all the positive studies start being published?  

          • kipper7 Jun 6, 2011

            “When the facts change, I change my mind. What do you do, sir?”

          • Anonymous Jun 6, 2011

            So you will cover your ears and pretend it never happened.  

          • Anonymous Jun 6, 2011

            Both are correct depending on what part of the BWG Phase you mean.   We do need new negatives after all those finding the virus get a 50% positivity with close contacts.

          • Why would Mikovits and Ruscetti choose a “close contact” as a pedigreed negative for a +1 year study that takes four seperate phases? 

            I don’t know if it’s true, but you said it Gob. Wouldn’t that be a criminally stupid thing to do?

            Also, regarding the CDC switching assays: they did in fact use the same assays but also tried some new assays. It just doesn’t make sense te repeat that tripe ad nauseum. I’ll just again quote from the transcript (that you think I don’t know):

            “In [round IIb], the CDC, unlike the first round [IIa], found all the samples to be negative. Again, they ultracentrifuged prior to extraction from the plasma. They used the same assays, in addition to a couple new assays”

            Literal quote, Gob. Stop spreading the conspiracy tripe.

          • Anonymous Jun 6, 2011

            As they were negative.  You cannot account for who will become infected when the estimates in healthy people is so high.  When I say close contact, it is not the kind you think.  

            The CDC did not use the same assays in the BWG Phase IIb, they were all new.  If you look at the slides.  They are new assays.  

          • “In this round, the CDC, unlike the first round, found all the samples to be negative. Again, they ultracentrifuged prior to extraction from the plasma. THEY USED THE SAME ASSAYS, in addition to a couple new assays”
            http://www.fda.gov/AdvisoryCommittees/CommitteesMeetingMaterials/BloodVaccinesandOtherBiologics/BloodProductsAdvisoryCommittee/ucm239304.htm

          • Anonymous Jun 6, 2011

            NAme the assays then.  

          • I “named” a literal quote from the BPAC meeting. 

            Are you saying the presenter of this information was lying?

          • Anonymous Jun 6, 2011

            They did not use the same assays.  If they did you could name them.

          • That is logically not true.

          • Anonymous Jun 6, 2011

            You still cannot name them!

          • I just said that your statement is logically false. Do you concede that?

          • Anonymous Jun 6, 2011

            Name the assays?  The CDC did change them from IIa to IIb.

          • Anonymous Jun 6, 2011

            No they didn’t, as I have posted the assays used.

          • So the presenter is lying?

          • Anonymous Jun 6, 2011

            Which study?  The slides show you the assays are different.  You don’t know what you are looking at.  

          • Anonymous Jun 6, 2011

            CDC Phase IIa.  These are the assays that detected XMRV in  plasma.

            Nested PCR XMRV gag, qRT-PCR (pro), qRT-PCR (int)

            CDC Phase IIb, plasma assays.

            Nested RT-PCR for XMRV gag & env, qRT-PCR for MLV-related gag & int

          • kipper7 Jun 6, 2011

            Name the company offering commercial XMRV testing, Gob?

          • Anonymous Jun 10, 2011

            Co-operative diagnostics, who have never proven their test capable of detecting the virus.  They sold that assays for many months.  I believe Coffin described it as alarming.  But the CDC is working with them and now they have withdraw the assay after still failing to prove it can detect a positive.  No refunds. The CDC didn’t have a problem with that assay. Whereas the WPI have validated assays and are a none profit.  

            Then there is the money paid by taxpayers to help Government researchers design tests.  Millions have been lost to unvalidated assays that the public has paid for.

          • Anonymous Jun 6, 2011

            How about you say what you think the assays were first.  Then I get to show why you have no clue.

          • What is wrong with the literal quote from the BPAC transcript, Gob? Mikovits and Alter were present to prevent the cover up. 

            The transcript states the CDC has used the same assays in phase IIb as in IIa. Get over it.

            Only, because the CDC used more than one assay, not all of the information is on a single slide. Perhaps on a slide (that you religously choose to believe contains all the information there is), they did only mention the newly used assays, but the CDC did also use the assay from phase IIa. 

            It’s in the transript. Literally. Or should I repeat the quote for you?

          • Anonymous Jun 6, 2011

            The assays on the slides change.  Please list them if you can?

          • I explained about the slides, Gob. 

            Please state what is wrong with the quote I provided from the BPAC transcipt, confirming that the CDC used the same assays in Phase IIb.

          • Anonymous Jun 6, 2011

            State what the assays were?  You haven’t got any idea have you.

          • Oh, the irony….

          • Anonymous Jun 6, 2011

            Cornered now aren’t we.  

          • I am not at all, really, as I have a literal quote from the BPAC meeting, where Mikovits, Alter and Lo were present, to back up my assertion. You, on the other hand, have absolutely no evidence to the contrary.

            Oh, and please post the evidence of WPI’s serological results for the BWG. Unlike you, I am perfectly willing to reassess my opinion based on new evidence.

          • Anonymous Jun 6, 2011

            Still not said what assays were used.  One last chance.

          • Still not posted the WPI’s serological results for the BWG. You’re surely not lying about their existence, are you?

            And still you haven’t said what is wrong with my LITERAL quote from the BPAC transcript. It shouldn’t be hard, Gob.

            Oh, damn, blew my “last chance”… 😉

          • Anonymous Jun 6, 2011

            The WPI serology results are not in the BWG, as you know.  But they had concordance with the NCI results.

          • Yes, that is why they CHOSE these samples.

            When you then CANNOT replicate these findings in a blinded setting, you have a HUGE problem.

          • Anonymous Jun 7, 2011

            That is not how the BWG saw this Phase.   Flawed thinking from yourself there too.

          • You are being childish here, RRM.  

      • WPI did not do serology for the BWG, Gob.

        There was no concordance. Please see the slide I have posted for your convenience.

        • Anonymous Jun 6, 2011

          The WPI results are not in the slides, if you look.

          • The WPI’s results are invisible, like the virus? 

          • Anonymous Jun 6, 2011

            Except that the Cleveland clinic and NCI confirmed them.  Then the FDA and NIH did.

          • The CC “confirmed” 7 out of 101 samples. Great confirmation.

          • Anonymous Jun 6, 2011

            They only tested 11.

          • No, they tested all 101 using that same assay. It’s in the addendum to the Science paper:

            “The remaining 90 samples described in the paper exhibited very few XMRV-gag specific PCR products and no env specific PCR products following single round DNA PCR of DNA of unstimulated PBMCs.”And thus:”only 7% of our 101 patients’ PBMCs exhibit products upon DNA PCR

          • Anonymous Jun 6, 2011

            “XMRV gag sequence. Detection of XMRV was confirmed in 7 of 11 WPI CFS samples at the Cleveland Clinic “

          • Yes. It was confirmed in 7 out of 11 “highly viremic” patients. The other 90 patients were negative, as you can clearly conclude from the quote I’ve provided.

            You understand the addendum is a clarification, right?

          • Anonymous Jun 6, 2011

            They did not test the remaining patients with that assay in Lombardi et al.

          • Who cares if they did it before or after? Fact is that all patients were tested and a whopping 7% was found to be positive using that assay.

          • Anonymous Jun 6, 2011

            The assay is not as specific as Nested RT-PCR.  What don’t you understand?  

          • I am glad you concede that it is 7 out of 101 and not just 7 out of 11.

          • Anonymous Jun 7, 2011

            Not in Lombardi et al

          • 7 out of 101, Gob. Published in Virulence. Great “confirmation”….

          • Anonymous Jun 7, 2011

            The figure in Virulence is 75%.

          • The figure is not 75% for the assay that the CC used for validation.

            That figure is 7% and you know it.

          • Anonymous Jun 7, 2011

            When did you say it wasn’t? 

            How can I explain this to you, again, when I already have.  Not all assays are going to function as well as others.  That is why you have to keep improving on them.  This assay, being PCR only, is very unlikely to be able to identify those infected becuase they are looking in blood.  As we all know, the virus clears from the blood, so it is very difficult to detect.  In Lombardi et al the CC tested 11 patients who showed signs of being higly viremic.  You should know this, but I guess not. 

          • If you had read better, you should know that I already stated that they were “highly viremic”.

          • Anonymous Jun 7, 2011

            So you have no point then.

          • Anonymous Jun 7, 2011

            Not in Lombardi et al

    • Anonymous Jun 8, 2011

      Here is the conclusion of Phase II and the slides that show the CDC switched assays after they detected the virus.

      • Like I explained (perhaps you missed it), it could very well be that in the slides, they are not showing every assay that was used and are focussing on the additional assays.

        More importantly, there is one “positive” assay in that Phase IIa slide that was also used in Phase IIb according to that other slide you yourself posted: qRT-PCR (int). While you could assume (without additional) evidence that one assay was for XMRV integrase and the other was for MLV integrase, it doesn’t seem very likely to me: first given the quote by the presenter about the CDC using the same assays in Phase IIb as they did in Phase IIa and second, based on the fact that they were unable to see whether the reported sequences were XMRV or MLV.

        And to go back to the first paragraph, even  if you could show that, it would even begin to prove that they indeed abonded their working assays.

        Finally, it doesn’t make sense at all to abandon a working assay, but still report that it did work for everyone to see. 

        P.S. Thank you for addressing the issue with actual material that you think supports your argument.

        • Anonymous Jun 10, 2011

          All assays are listed in the slides.  The qRT-PCR XMRV (int) in Phase IIb had different cycling conditions and reagent concentrations than the qRT-PCR (int) in phase IIb.  They are not the same assay.  

          If you know it does not make sense to have changed assays, why are you not asking the CDC for answers?

          • You’re again becoming nonsensical.

            You posted slides that presumably showed that the CDC supposedly switched assays. When I pointed out at least one of the two “new” assays looked exactly THE SAME as the old one by its description from the slides and from the transcript, you suddenly assert (without providing any evidence whatsoever) they switched assays “anyway”.

            Supply use with some EVIDENCE  that these assays differed in “cycling conditions and reagent concentrations”.

            P.S. Have you stopped beating your mother?

          • Anonymous Jun 10, 2011

            As they also changed the cycling conditions and reagent concentrations.  Do you know anything about PCR?

            Contact the BWG and ask.

          • That is not an answer, Gob. You’ve TRIED to supply us with evidence that the assays were not the same, and now that you have FAILED, you resort to your usual “contact someone and ask”.

            I am perfectly willing to stand corrected. Just provide the evidence or conceed the argument.

          • Anonymous Jun 11, 2011

            The assays had different cycling conditions and reagent concentrations.   That is a fact.

            Ask the BWG.  You won’t because you know it is correct.

          • You are again not addressing the issue, Gob

            First (when you thought you were right) you were very willing to provide a source for your assertion. When I pointed out the error in your source(s), you resort to silly ‘ask the BWG’ statements.

            Just provide us with a reliable source or concede the argument. It shouldn’t be hard if your statement is “a fact” as you claim it is. 

          • Anonymous Jun 11, 2011

            RRM, do you need this said to you in a different way.  The assays had different reagent concentrations and cycling conditions.   The BWG is the source, ask them.

          • Do you need this to be said in a different way?

            If one makes an assertion, one is ecpected to back such an assertion with proof. Please provide such proof, or conceed the argument.

            P.S. If toy read back, you’ll see that this is only the first of hurdles to take to somehow prove the CDC did “abandon” their working assays. It’s really pretty sad that we’re still at this first hurdle. Think of what time you could have saved both of us by providing a proper and reliable source 9if you have one). 

            P.P.S. It lies at the root of scientific integrity to share data with others. But of course, you know this.

          • Anonymous Jun 11, 2011

            The proof can be obtained from the BWG.  If one wants evidence and they are told where to find it, then all you need do is go to that source.  But you have no intention of finding out the truth.

            The CDC changed all their assays.

          • Translation: Gob doesn’t have a source otherwise Bob would be posting it…

            (…as he evidently did with the slides he thought were a source…)

          • Anonymous Jun 11, 2011

            The source is the Blood XMRV working group.  Not hard to find them.

          • If it is “not hard” to post the source of your assertion, why won’t you simply post it? At least, while wrong, you’ve at least tried so earlier. 

            I know you will drag this until the post will get unreadable without posting an actual source. Is it that hard for you to just prove me wrong with this minor point instead of doing that?

          • Anonymous Jun 12, 2011

            This time you actually have to email, phone or write a letter.  They will confirm that the assays had different reagent concentrations and cycling conditions.  You must really hate that the CDC did that, to continually be in denial.  

          • Okay. You don’t have an actual source yourself. Just wanted to know that, really. Thanks.

          • Anonymous Jun 12, 2011

            Blood XMRV working group.  

  17. Publishing an “expression of concern” by “Science” has simply thrown egg all over its own face. The original paper by Lombardi et al was very carefully vetted by Science, who insisted on extra work to prove lack of contamination. No fraud was involved. So WHY the request for retraction? We have all known that ME(CFS) is caused by a retrovirus since about 1985 when Dr Paul Cheney showed MRI scans to a specialist who in return showed him scans from AIDS patients – they showed the same lesions. Then Elaine DeFreitas found a retrovirus in her ME patients in about 1991; her work was suppressed when the CDC couldn’t duplicate it (using different methods). The WPI team may well have the right answer. Mikovits and her crew spent 8 months tweaking their techniques, honing & polishing them, and this is a work still in progress. They still won’t commit themselves to claiming that XMRV is the cause of ME, as there are some more hurdles before Koch’s Postulates can be proven. But what else can it be? Given that the cause of ME has been known to be a retrovirus for the past 25 years.

    As a “scientist” (retired vet) and keen to study all microbes, I have grown Mycoplasma in the lab and wrote my Masters thesis on the subject. The WPI studies on XMRV appear to be genuine with no fraud. So why all the negativity? There are obviously many anti-XMRV vested interests involved to muddy the waters. Just ignore all the non-replication, cheap & nasty, quick & dirty, negative studies. 

    But exactly WHY does this huge anti-XMRV movement exist? Surely true scientists would be looking to find the real facts, and not trying to stymie the work in progress? The non-replication negative papers are worthless and the suggestion that XMRV could be either a contaminant OR a new virus generated in the lab, is simply speculation, no more. “Science” editor Mr Alberts does himself no favours in presenting his “expression of concern”, which is so premature as to question his integrity as a scientist, and implies that he has been “leant on” from above.

    • drosha Jun 6, 2011

      “We have all known that ME(CFS) is caused by a retrovirus since about 1985”

      Who are the “we” in that sentence? I don’t understand why all these patients think that there is a conspiracy against them. It’s at the benefit to the scientist if there is a retroviral cause for this disease, because it gives them another virus to work with (which means more grants). Considering that tens of papers were published since the discovery of the virus, people were eager to work on it. But if it is just for nothing, then it’s a waste of taxpayer money and scientists’ time.

      Expression of concern is written to make sure that the reader takes a precaution when they read the paper and don’t reach conclusions by that paper alone, since many others have contradicting results.

      • Anonymous Jun 6, 2011

        How do the Science editors feel this week, with a study being presented at a conference that shows XMRV is in the blood supply , with a blood transfusion study and one of the authors of Knox et al. now having an assays to detect XMRV in humans?

        • drosha Jun 6, 2011

          I doubt that science editors will act on meeting abstracts. The presence of the virus in the blood supply doesn’t say anything about its ability to cause any disease. Nobody is saying that this virus doesn’t exist. It’s the association with CFS that’s being questioned.

          • Anonymous Jun 6, 2011

            They are acting on this:

            I’m afraid it has now been reported that this strain of nude mice, NU/NU and Hsd were not used in the preperation of the 22Rv1 cell line.The authors of the paper have been contacted by the editors of Science and have been asked to deny this fact. We will await their response with interest!  I believe that this matter is to be discussed in the conference in Belgium.  

            The most likely explanation is that these sequences were actually transferred from humans to the mice.  Which should have been proposed in the paper. This has been reinforced by the fact that this mouse strain has been kept isolated from wild mice since its creation. Knox et al. used the PCR assay which had only detected gag sequences in 7% of patients in the Lombardi study when testing Dan Petersons patients and reduced the DNA concentration while doing so and for good measure increased the annealing temperatures.  The likelyhood figures are just plucked out of thin air.  

            Xenotropic Polytropic hybrid MLVs are routinely generated in infected mice.  The use of PCR assays, which have high analytical sensitivity but unknown clinical sensitivity, should be discouraged as negative findings do not prove the absence of target viral sequences.  20 months have been lost because of this fiasco.

          • drosha Jun 6, 2011

            You know your posts look more like spams, since you keep copy pasting the same paragraph.

          • Anonymous Jun 6, 2011

            What do you think about this issue?

          • drosha Jun 6, 2011

            “The use of PCR assays, which have high analytical sensitivity but
            unknown clinical sensitivity, should be discouraged as negative findings
            do not prove the absence of target viral sequences”

            This is a ridiculous argument. And only a person who has no idea how PCR works can make this claim. If only certain primers can detect a virus, then either the sequence is wrong, or the virus doesn’t exist at all. Since the virus actually exists, and the sequencing has been done several times, it means that hypothesis doesn’t hold. This virus integrates into the genome. It’s part of the genomic DNA. a primer set that is identical to the sequence should be able to detect the presence of it easily. If your theory of “only certain primers work” was true we would’ve never been able to sequence the human genome in the beginning. Do you have any theory on to why only certain primers may work?

          • Anonymous Jun 11, 2011

            No scientist can claim an assay can detect a virus in humans if it has never been shown capable of doing so.  They would also not be able to claim, as you have, that changing variables would still produce the same result.  This is science 101.   What you are doing is speculating and not testing that hypothesis, but you are no scientist.

            Your post is actually rather messy and confuses several issues.  Not one study has attempted to replicated Lombardi et al.  Lo et al. has validated it.  I’m guessing this is what you intended to say when you used the word “sequencing”.  The primers are one variable of PCR.  Where have I stated that only primers influence the chemical reaction?  If you know anything about PCR you should now be able to list the other variables.

          • If this is “science 101”, you should be able to provide us with these “101” examples of validation studies that have used your scientific methodology. You are not providing us with such an example to open our eyes to this age old “science 101”. 

            Is is because:a) you don’t want to give information to the “other (or lazy) side” (this would be unscientific)b) you don’t have the time/energy to do this (unlikely as ad nauseum repeating your statements without evidence is costing you much more time/energy than posting such a study would if it actually existed)c) you cannot provide us with an actual “science 101” example of such a validation study
            d) other, more specifically……

            I have much faith in you as a scientific genius, and I do not want to challenge your unprecedented knowledge in the field, but slowly I am starting to suspect it perhaps might be answer C…

          • Anonymous Jun 11, 2011

            HIV and HTVL  Would you like some that don’t include human retroviruses? 

          • Just provide us with a single study. Stating “HIV and HTVL” is not producing data that others will be able to scrutinize properly.

            If you concede that you are unable to find such an example in the history of virology, you are more than welcome to provide examples outside of the field. 

            Remember that we need:

            a) a study with an original finding (just saying a single word like “poodle” won’t do)
            b) a validation study that used the supposed positive finding of the study it was trying to validate, to validate its own methods that were used to validate the original study

            And this without the whole world laughing at you. 

            Will you post this or will you again resort to posting things like “call the CDC/BWG” or “read it again/search better to find the truth”? 

          • Anonymous Jun 12, 2011

            You are repeating yourself again, even after being told exactly where to find the information.  Are you not up to the task of finding these studies?  Originally you said it must be the same field, so I provide two answers.  Montagnier sent Gallo positive samples of HIV.

          • If you look back, I had already addressed the Montagnier/Gallo studies.

            However, despite the fact that Montagnier sent Gallo samples (Like Mikovits sent some samples to Van Kuppenveld and also to Blomberg), Gallo did not calibrate his assays to the known positives that Gallo had sent him to actually confirm his finding. 

            You are actually delusional if you think that sending some samples for others to check means that the other party will calibrate their assays to these supposed positives. No scientist in the history of virology would do that as it would then stop to be a validation study and instead would turn into a circular and dependent (and therefore useless relative to its purpose) experiment.

            Give it up. It’s not a problem.

          • Anonymous Jun 12, 2011

            Then how did he end up with the same virus?  

          • “Then how did he end up with the same virus?”

            Think, Gob, think. Do you really believe that Gallo finding the very same virus in some way indicated that he CALIBRATED his assays to the Montagnier sequences?

            Hint: if Gallo calibrated his assays to Montagnier’s positives, it should be in the Gallo paper, Gob. It’s not.

            How hard can it possibly be to find an actual quote from an actual paper that proves you are right if you are right and this is “science 101”? Very hard, apparently.

          • Anonymous Jun 12, 2011

            Positive samples were sent to Gallo on several occasions before he published.  Not for inspiration.  Gallo even used an image of Montagniers virus in his paper.  

            “One crucial fact that has now emerged and was finally acknowledged by Dr Gallo last year is that Gallo’s virus, which he announced in 1984, is the same
            virus as the one that Montagnier had sent to him the year before.”

            http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1881839/pdf/bmj00073-0071.pdf

            Here is another example of virologists sending positives to replicate the work of others:” In 1975, Gallo and Robert E. Gallagher announced that they had discovered a human leukemia virus, but other laboratories were unable to replicate their results. Scientists to whom they had sent samples for independent confirmation had found two different retroviruses not from humans, but from animals. The samples had been contaminated by viruses from a monkey or a chimp.”http://www.enotes.com/microbiology-encyclopedia/gallo-robert-c

          • Boy, it must be really hard to find that quote.
            P.S. I know scientists send samples around. I can find a billion of sources for that too. For instance, I have already discussed the Gallo bit here: http://www.microbiologybytes.com/blog/2011/03/29/xmrv-the-fight-continues/However, that does not mean (at all)  that these other scientists will calibrate their assays to these samples they receive, in order to validate the finding. After all, they are not crazy.

          • Anonymous Jun 12, 2011

            Are you dense?  They ask for and received the samples to confirm their assays worked. 

          • I am not dense Gob. They did not calibrate their assays to the “known positives” of Montagnier. These people are not stupid. 

            BTW: I really like how you keep reframing your argument. That is not a definition of calibrating to known positives, Gob. You should know that.

          • Anonymous Jun 13, 2011

            How strange that the same virus, from the same patient, was in sample that was in the paper, or that an image of Montagniers virus was in the paper.

          • You apparently find this strange, I don’t, but whatever.

            The point is that it is no way an indication that Gallo calibrated his assays to “known positives” he received from Montagnier.

            Come one, Gob. Everybody knows this. Nobody has ever used your proposed methodology in the history of (retro)virology.

          • Anonymous Jun 15, 2011

            That is why he wanted positives.  Every school child to fully fledged scientists knows you cannot claim an assay works without evidence.  Ila Singh has also stated that it is not good enough to use a spiked sample as the matrix is different and then proceeded to do the opposite.  

        • It doesn’t show that. It provides some evidence of it being in the blood supply, while other evidence contradicts the idea that XMRV is in the blood supply.

          In fact, Science was well aware of this conference and its abstracts before issuing the Editorial Expression of Concern, with shows you how strong they find the the data of Paprotka et al. (and to a lesser extent Knox et al.).

          • Anonymous Jun 6, 2011

            The same authors are on a negative paper claiming the results are mouse viruses and now say XMRV is human.  If the Science editors knew, come on, then they have egg on their face.

          • These authors didn’t say that XMRV are mouse viruses. These authors said it weer probably mouse viruses in the CFS findings. But I am sure you knew that, right?

          • Anonymous Jun 7, 2011

            Not quiet.  Lombardi et al found XMRV, which is not a mouse virus and is a polytropic xenotropic hybrid. Lo found polytropic and modified polytropic sequences.  The new WPI sequences are polytropic and modified polytropic.    None are found in mice.  

          • You are diverting from the subject, Gobster.

            We were talking about what the auhtors of one the negative studies asserted, not what you are spamming about  polytropic xenotropic hybrids.

          • Anonymous Jun 7, 2011

            Mouse contamination in a lab cannot be used to support a contamination claim, as you know.  Otherwise we would never detect a mouse virus, because clearly all those labs with proven contamination have failed to keep everything clean.  Then again those with mouse contamination in their reagents is slightly different and thus why you have to check for this before you begin.  Lo et al found polytropic and modified polytropic sequences.  If XMRV is a hybrid and a human virus.  Lo did not find mouse viruses as you obsessively wish they had.  They also ruled this out, including usnig Coffin’s unvlaidate IAP assay.

          • ” Lo did not find mouse viruses as you obsessively wish they had.”

            Lol. I have never said anyhting about Lo being mouse viruses, IIRC. This is the first time someone accuses me about having emotions about mouse viruses.

             I don’t care if they are or not, but it is rather unikely that is (poorly reviewed) study will hold up. We’ll see in the Lipkin study and I bet, if it doesn’t, you will cry foul instead of conceding the argument. I promise you that I will not (as I am not reasoning in circles to keep up my truth beliefs).

          • Anonymous Jun 7, 2011

            Then you are now claiming no one has said that Lo or Lombardi et al found mouse viruses.  Good, the evidence shows they didn’t.  The Lipkin study is an exercise.  Only the one study.  We will get more positive studies before then.

          • You are again willfully misrepresenting my point, Gob. What is the matter with you? There is nothing wrong with disagreeing, but you shouldn’t resort to blant lying. For instance:

            “Then you are now claiming no one has said that Lo or Lombardi et al found mouse viruses.”

            Where did I say or imply that? I said that *I* never said that. 

          • Anonymous Jun 7, 2011

            Thank you again. Yes XMRV is one variant of HGRV associated with ME and prostate cancer.

          • Anonymous Jun 7, 2011

            Lombardi et al found a polytropic xenotropic hybrid called XMRV.  Lo et al found polytropic modified polytropic sequences.  The WPI have also found polytropic and modified polytropic sequences.  

      • By “We” I mean everybody. Dr Paul Cheney’s clip on YouTube shows him looking at the UBO’s (unidentified bright objects) in MRI scans of both AIDS and ME(CFS) patients. Elaine DeFreitas’ 1990 paper is on the Web. Her electron-micrographs show the virus, which appear similar or the same as the WPI’s, inside mitochondria – a discovery which explains a lot of the “fatigue” suffered by ME(CFS) patients. 
           As no-one hitherto has even attempted a proper replication of Lombardi & Mikovits’ work, despite the WPI offering to share all its expertise, protocols, samples and reagents, the Lombardi et al paper still stands. 
            An “Editorial Expression of Concern” is normally only used when there has been evidence of outright fraud. It is deprecatory to the magazine’s reputation to issue one, and very unusual in respect of an article where the field is still wide open and there are many more investigations in the pipeline. It was a huge mistake for the Editor to take this action. not only do the recent studies fail to prove that XMRV doesn’t cause or isn’t associated with ME(CFS), but the mudslinging rumour about “contamination” is pure speculation and totally wrong on all levels. Science was reluctant to publish the paper in the first place, being that the WPI was new to Science as the Institute had just been established, so they made the WPI run many extra tests to prove to everyone’s satisfaction that there was no contamination. The XMRV virus is not a mouse virus – it can’t multiply in lab mice; the WPI had no mice nor mouse tissues in its lab; and all their reagents, like the heparin used to prevent blood clotting, were also carefully tested for contamination. The trouble is that the XMRV virus is not only very small, it is very elusive, only found in very small numbers in the blood as it hides away in deeper organs. It is fragile and easily damaged by repeat freezing or wrong blood anticoagulants. If it were easy to find, we could have found it years ago. The meticulous techniques that the WPI needed to develop to find it, took them 8 months to develop, to tweak, hone and polish. They didn’t just use the basic PCR test, which was all that the negative studies used, but they amplified the virus by multiplying it in a special human cell line; they used a complicated “nested PCR” test for identification; they sequenced its genome; they took electron micrographs of it; and they found that many of the patients’ samples contained antibodies to it, something that would be impossible if it were due to sample or laboratory contamination. 
            As for your mention of “conspiracy”, please read “Osler’s Web” by Hillary Johnson (essential reading), and also her blog piece entitled “The Why”.   

        • drosha Jun 6, 2011

          I’ll give you a quote from profvrr for your mitochondria theory: “Complex retroviruses such as HIV-1 and HTLV-1 cause mitochondrial

          permeability, swelling and fragmentation during infection. I don’t

          know of any reports that such activities are observed in cells

          infected with simple retroviruses like the MLVs. These mitochondrial

          changes are related to induction of programmed cell death (apoptosis).

          I’m not aware of any reports that XMRV induces apoptosis in infected

          cells. Based on current data, it seems unlikely that XMRV would cause

          mitochondrial dysfunction.”

          “By “We” I mean everybody.”

          So you don’t include me or people I know or the crew of this podcast in your definition of “everybody”

          • Sorry, Drosha, but you do appear to use funny logic – similar in fact to John Coffin* et al. Non sequiturs everywhere. “Everybody” means just that. It’s ALL on the Internet, free for everyone to browse, though you may have to google something or do a search on YouTube. Thank goodness for the internet, and for the fact that people have kept, and posted, old video clips going back to the Incline Village outbreak of ME in 1984. Get back to me only when you’ve read Osler’s Web.
              *”Because I can’t find it, it can’t exist”.

          • drosha Jun 7, 2011

            This has nothing to do with my logic everybody means everybody. If you don’t know the actual meaning of the words in your native language then it’s your problem.

            So when I say everybody named Laurence, can I just not put you in that category? You can’t even accept that you’ve made a mistake by using that specific word and just try to justify your mistake with useless arguments. I pity you for that.

        • Lance Jun 7, 2011

          UBOs are found in the normal population.

          For more detail on when retraction should be warranted see http://retractionwatch.wordpress.com/

          It’s not only the PCR which can’t be duplicated in another lab but also viral culture and antibody assays.

          • Yes, UBO’s can be found in the brains of seemingly normal people. Usually they may be the result of a small amount of brain tissue damage, maybe a tiny micro-aneurysm, but they are always in the same place. In the case of HIV and ME (XMRV), they appear to move or migrate, so consecutive scans are not the same. This could also be the case if the patient were to be a “carrier” of one of the viruses, like the XMRV-positive “controls” in the WPI’s first paper, probably symptomless or with such mild signs that they did not ascribe them to a disease, such as a frequent headache or other flu-like signs.

  18. Justinreilly Jun 7, 2011

    Why exactly is it that every fake anti-science “CFS” study is just peachy, but one of the best bona fide ME studies of all time is asked to be retracted?? Based on the fact that some inferior studies haven’t been able to confirm it, while others, published and unpublished have? This is obviously just one more transparent attempt to crush ME patients and science. http://www.cfsnovel.com/blog/?p=3

    • Lance Jun 7, 2011

      Why would anyone want to do that?

      • I can’t see in ‘their’ heads so can’t say for sure.  Partly it must be out of sadism for some like Simon Wessely.  Other motives most probably at play: protecting insurers from having to pay claims and provide treatment; CDC administrators protecting themselves after misappropriating almost the entire budget for ME for many years and lying about it to Congress year after year; sexism; inability to say ‘I don’t know’.  If governments and or drug companies are responsible in some way for creating or exacerbating the epidemic, eg by vaccine injury, then obviously that would be a motive; it is unknown if this is the case.  

        I and many other ME patients have studied the science and history for many years each; I don’t say these things off the cuff.  It is extremely upsetting for me and any other ME patient to learn that we are being abused by our governments, but this is the case. 
        see oslersweb.com and the gripping trailer for What about ME?:http://vimeo.com/10536172

        • Lance Jun 8, 2011

          My post above was supposed to be here – sorry.

        • Higgs Boson Jun 9, 2011

          Conspiracy theories are sometimes on the mark. In February
          this year Professor
          Stephen Holgate, Chair of the Medical Research Council (MRC) Expert Group on
          M.E., acknowledged that MRC funding has been systematically
          biased against research into organic causation. In a talk to the All-Party
          Parliamentary Group on ME

          ”Professor Holgate gave a brief history of M.E. research
          [funded by the MRC], and explained that scientific peer reviews had tended in
          the past to involve mainly those with a background in neuroscience. This had
          led to research that did not reflect the views of those who believed that the
          condition has an organic cause.” http://www.meassociation.org.uk/?p=5413

           

          This confirmed what many people know was going on, despite
          the angry denials by the psychiatrists and the NHS. However, why
          would scientists be uninterested in etiology? Holgate (himself a
          neuroscientist) may well have been using diplomatic language to describe
          psychiatrists. The Wessely school have been in control of ME perception and
          research for 20+ years, fighting hard to obscure the case description, to
          resist clinical and laboratory subtyping, and to deride ‘medicalization’ of
          what they allege is a neurosis. Apparently they also approved their own MRC
          funding applications, and turned down everything from biomedical researchers
          such as Jonathan Kerr.

    • Please cite what you consider a “fake anti-science CFS study”

      What is bona fide to you?

      Guess you like fishing?  RED HERRING..

      • Anonymous Jun 7, 2011

        Unvalidated assays makes the studies worthless for humans.

        • Guest Jun 7, 2011

          Apparently Gob987..ah Gerwyn, should inform Mikovits the reason for the disparate results from the other labs. In a statement in the WSJ with Amy Dockser  Marcus, Mikovits states: “Dr. Mikovits said it was still too early to know the reasons for the
          differing results in different labs, and that the Institute was looking
          forward to participating in a major study under way by the NIH and led
          by Columbia University scientist Ian Lipkin to help clarify the matter.”

          http://online.wsj.com/article/SB10001424052702303745304576355852212887170.html
          Chronic-Fatigue Paper Called Into Question May31, 2011

          • Anonymous Jun 8, 2011

            Mikovits knows the reasons as well as everyone else who is a scientist does. 

          • Gob987 and Gerwyn are not the same person, and both, like yourself, are allowed to post here, thanks to VR.

          • Guest Jun 8, 2011

            Geez, thanks Jane for the somewhat dubious verification…seems strange though since they come from the same ip address that Gerwyn uses.

          • That would surprise me.  How do you know?  Btw, I liked you by mistake, I meant to push the reply button.  I have been following this debate for over a year now, and I know Gerwyn’s writing style, and Gob’s is not anything like it.  

            Who are you?  I’m Jane Clout, myself.  

          • I think I have to agree with Jane on this. I think there are substantial differences: where Gerwyn’s level of knowledge is quite a bit above Gob’s, Gerwyn’s writing style is much worse. Their approach to scientific methodology and discussion seems largely the same. If I had to guess, I’d say Gob would most probably be v99. 
            However, it is of course very much possible that Gerwyn has also used this same nickname on other occasions.

          • Guest Jun 9, 2011

            @8e71d41d5ee3c6d3fd3b5bee4c9a036d:disqus
            Could be RRM but he does catch you in the same logic loops as his other posts under different aliases using Red Herring, Strawman etc.

            You ask him to respond to a specific question, he answers with a question unrelated to the question you asked him…typical debate tool when someone doesn’t want to concede a point and wants to divert attention away from the original question….typical Gerwynian.

            Gerwyn admitted in his profile that he had ME/CFS and his only a psychology graduate but then changes it to other degrees as he see fits in other postings. He has no scientific education in the field of retrovirology, lab experience, or training, yet is able to spin off his analysis on scientific research papers at an incredible rate and lecture the most prominent and prestigious retrovirologists in the world on how to conduct PCR assays and scientific research.

            He is fixated on PCR assay validation and scientific methodology…pure Gerwynian and is absolutely has a closed mind to even the possibility that he is wrong on some of the most minute analysis that differs with his on XMRV research.

            a psychology graduate with severe ME/CFS a few years ago can in a span of  2 years  be competent to challenge the leading authorities in the science of  retrovirology is beyond comprehension. Besides his other background is in philosophy with a certain mentor in the Netherlands.

            Either Gerwyn is a pseudonym of another scientist lurking behind his name or someone is feeding him the information. Anyway both ip addresses are located in the UK at the same location, same host name, same public location.

             

          • I note you have neither given us your real name, Guest, nor told us the source of your information re ip addresses.  Therefore I have to discount your ‘information’ as conjecture.

          • Guest Jun 11, 2011

            Well, Jane that would be giving up too much information as I am monitoring for other reasons. Since it is relatively easy for me to tunnel under his many proxy servers, he keeps changing….so many different aliases, degrees, email addresses etc. and naive to think public computers at universities or public locations are safe..hint, hint… should be sufficient as well as below.

            Nederlog

            Ah me! alas, pain, pain ever, forever!
                No change, no pause, no hope! Yet I endure.
                I ask the Earth, have not the mountains felt?
                I ask yon Heaven, the all-beholding Sun,
                Has it not seen? The Sea, in storm or calm,
                Heaven’s ever-changing Shadow, spread below,
                Have its deaf waves not heard my agony?
                Ah me! alas, pain, pain ever, forever!”
                     – (Shelley, “Prometheus Unbound”)

            John Davies

          • Jane Clout Jun 12, 2011

            So now I know who you are, and I know how far from the truth you stray.  Your motivation is unclear, unless you just enjoy making enemies.  Note, I am not outing you because I know that you, too, are ill.

            Gerwyn is a sick, technologically challenged academic who can no more  duck and dive the way you suggest than I could make my home on the moon.
            “Be on good terms with all persons, as far as is possible without surrender”  Desiderata.

            Jane Clout.

      • How is this a red herring?  It is the big picture which lends context to the present situation.

        Bona fide science is just that, science done in good faith, ie without any bad faith such as using fake definitions (ie Sharpe 1991 and Reeves) of “CFS” in order to muddy and retard the science.  This and other bad faith tactics are used by CDC and a small cadre of insurance lobbyists trained as psychiatrists and posing as scientists that put out many of these fake studies and lie about the science.  These studies are readily published, while many bona fide ME studies like Lombardi et al. are subject to an unfair level of oprobrium.

        For example this recent study by CDC using the fake Reeves definition, shown by Prof. Jason to select a cohort of which only approximately 10% actually have ME/”CFS” :
        http://content.karger.com/ProdukteDB/produkte.asp?Doi=319312

        A good op-ed piece in NYTimes:
        http://www.nytimes.com/2009/10/21/opinion/21johnson.html

        • Lance Jun 8, 2011

          Yes it’s a popular school of thought that, and I can see why. I am a
          physician with some experience of diagnosing and treating CFS patients
          and I have seen many times for myself the desperation and frustration of
          patients when I simply cannot give a satisfactory explanation for the
          cause of the illness. But I am mystified why any physician would be
          “sadistic” to patients. I am sure some physicians don’t want anything to
          do with CFS – they can achieve this by working in specialties where
          they will never encounter CFS. Or they can work in specialties that are
          narrow so they can say “your […insert favourite organ here…] is
          fine, I’m afraid your problems are outside my area of expertise.” Don’t
          forget doctors experience counter-transference and therapeutic despair
          so looking after unsatisfied patients (and rightfully unsatisfied too)
          can be very draining and unrewarding (though obviously nothing like as
          bad as having an unexplained medical condition, feeling awful and being
          treated as if there’s nothing wrong with you).

          For me it is a big jump to go from negligence of omission (avoiding CFS)
          to negligence of commission – effectively trying to inflict harm on
          people (for example by deliberately suppressing advances in the field). I
          know this is how many people who experience CFS feel, but it runs
          counter to everything that physicians stand for so for me it requires
          hard evidence. Actions like this would be taking a big risk on the part
          of the physician – if actively trying to harm were ever proven that
          would be the end of their job.

          As far as money is concerned – well I cannot comment on insurance. I am
          fortunate to work in a socialised healthcare system where we don’t face
          the issue of insurance coverage. It can’t be all down to research grants
          – you would be a fool to try to make your fortune bringing in (or
          misappropriating) research grants for CFS – it’s so woefully underfunded
          as is frequently pointed out! In fact come to think of it you’d be a
          nutter to think you can make your fortune trying to get research grants
          for ANYTHING at all (oh shit what am I doing…). Simon Wessely could
          very easily start doing clinical trials on antivirals if he has a lot of
          patients, though it is true that the condition would switch to the care
          of infectious disease physicians if antivirals were involved so this
          could be a competing interest. However, one competing interest doesn’t
          make a conspiracy.

          I am an ID physician, and I can tell you we just LOVE using
          antimicrobial drugs. I can’t make this point emphatically enough –
          they’re GREAT. Me find bug, me kill bug, me go home (to quote Mark
          Crislip). What could be better. You can really cure people, more so than
          many other branches of medicine. So I can tell you that, as a
          community, there is no way we would let  anyone prevent us from doing
          this if we thought it would work. I can just imagine floating home from
          work on a cloud of good vibes having spent the afternoon in clinic with a
          whole bunch of cured patients (a bit like HIV medicine in the early
          days of triple therapy). The idea that we would allow people to go on
          suffering whilst withholding something that would make them better just
          doesn’t make sense. If nothing else, physicians’ egos thrive on making
          people better! There would also be BIG money in this, money for
          epidemiology, virology, treatment trials, treatment programs etc. Much
          more than there is at present.

          As the presence of XMRV was only reported in humans 2 years ago it would
          seem that no governments could be held responsible for failure to
          prevent an epidemic (assuming for a minute that it does infect humans).
          HIV, hepatitis C and new variant Creutzfeld-Jacob disease (CJD) weren’t
          covered up. Why should this be any different?

          So to summarize – there would seem to me to be no motivation at all for
          physicians to suppress any association of CFS with XMRV, and every
          reason not to suppress it. I for one don’t have any competing interest
          in XMRV either way, I am following the XMRV story, and I can tell you if
          I thought anything were being suppressed I would be shouting it from
          the rooftops. I was excited (though a little skeptical) about the 2009
          Lombardi et al. science paper and was merrily practicing spelling
          RALTEGRAVIR. (That’s a joke – I know how to spell “raltegravir.”)
          However I have now seen the story unfold and I am of the view that XMRV
          is not currently causing symptomatic human infection, and is very likely
          not infecting humans at all. That is not say that it cannot, or will
          never. Yes I agree it seems most unlikely that, in some labs, only some
          samples show up XMRV positive and not the negative controls, and some of
          the antibody results are a bit inconsistent. However, I have to balance
          that against:

          1) The findings can’t generally be repeated (several methods)

          [Save for insisting on a degree of replication which would be unheard of for any other human infection]

          2) XMRV is inhibited effectively by the innate immune system

          3) XMRV doesn’t infect it’s target cell (PBMC) very well in culture

          4) The sequence diversity in cell culture is greater than that in human
          “isolates” [i.e. lack of sequence diversity despite an error prone
          polymerase – previously unheard of]

          5) The presence of identical integration sites [also previously unheard of]

          6) The virus is highly likely to have arisen in the early 90s well after
          many patients had developed CFS both in the studies and in the general
          population.

          No, none of these individual observations is proof.  However, something
          unlikely has happened, and the least unlikely thing is contamination.
          (If that’s not too many neg-neg-negatives.) Although the *pattern* of
          contamination seems unlikely, the *phenomenon* of contamination is not.
          It’s just asking bit too much to throw out all of the observations
          above. That’s not to say there couldn’t be some weird reason for it, and
          that we do end up re-writing some of the laws of biology. But we would
          have to have a very good reason to do so. Galileo is often invoked
          during arguments such as these, but Galileo’s observations were repeated
          many times over by other scientists and have stood the test of time.
          Currently this is not the case for XMRV. I repeat – that does not mean
          it never can be, but the totality of the evidence is against it
          infecting humans at present.

          What is even more unlikely, in my view, is some kind of conspiracy to
          cover it all up, which you really have to infer unless you write off a
          lot of the data.

          The fact I am left without any explanation for CFS does not mean that
          any particular alternative is true. But that doesn’t help the patients.
          In fact this issue is confronted in many cases of medically unexplained
          symptoms. Just search for “medically unexplained symptoms” or
          “therapeutic despair” in pubmed and google. I am left saying what I so
          often have to say to patients with all kinds of diseases, not just CFS –
          I simply don’t know. This is a big disappointment, but I think science
          is running its course here. Hopefully this will stimulate more research
          in the area. For now, there is no good justification for trying
          antiretroviral drugs for CFS, no matter how attractive this may seem.
          Some may not like that I know, and yes, I am being rather conventional
          and following the majority view. But it would be hard not to do that for
          someone in my position and if I did harm using antiretroviral drugs in
          this context I wouldn’t have a leg to stand on.

          I know some people feel resentful at the suggestion CFS might not be a
          physical illness. I have, on occasion, seen “physical” likened to
          “real,” implying that a mental illness (or indeed a psychosomatic
          illness) is not a real illness. Whatever your view on CFS (and I draw no
          conclusion on this at present), I object strongly to this point of
          view. Mental illnesses are very real indeed.  Just try talking to the
          relatives of someone who has committed suicide as a consequence of
          depression. I have looked after many injecting drug users, immigrants,
          asylum seekers and other disadvantaged groups with blood borne virus
          infections. Psychosomatic symptoms and mental illnesses are common in
          these groups and cause great distress. I have even seen people die
          because mental illness interferes with their antiretroviral treatment.
          When people with CFS ask me if I think it’s “all in their head” I tell
          them that I don’t know, and in any case there are many illnesses that
          are “all in the head” (depression, epilepsy, even a brain tumour, etc).
          In fact, come to think of it, our whole existence is in our heads
          (getting rather philosophical now). I mean, we can’t even fully explain
          why humans experience headache, yet we have all experienced it. You
          should never let anybody tell you you are not ill – you know this better
          than anyone. If you feel ill, you are ill. Plain and simple. Even if
          no-one can explain why.

          Sorry this is so long and rambling, but I don’t see the point of view of
          the caregiver put very often. This is the personal view of someone who
          is in the mainstream medical/academic field, has some experience of
          looking after CFS patients, knows how to use antiretrovirals, does
          research (not on XMRV) and has no axe to grind over XMRV one way or the
          other. I may not post again as there seems to be a lot of going round in
          circles, and I’m not going to debate the data in fine detail because I
          just don’t have time. In any case it’s pretty much all been said. I’ll
          let RRM and Gob fight it out.

          And if on the offchance XMRV does turn out to cause CFS? Well I’ll eat
          every word. (Maybe not EVERY word.) With great relish. In between
          recruiting patients to treatment trials and handing out ARVs.

          • Anonymous Jun 8, 2011

            Is there any reason to read this when you cannot correctly state when the virus was discovered in humans?

          • Lance Jun 8, 2011

            You’re quite right – what I meant to say was “reported in human blood” which has different implications to reporting it in prostate cancer alone .

            There is no reason to read it at all. Yet you clearly did – carefully! I am grateful for the opportunity to correct my mistake. Thanks.

          • Anonymous Jun 8, 2011

            What are those different implications Lance?   Can you name them?  I stop reading when I got to the first major error.

          • Lance Jun 8, 2011

            Well like blood transfusion for example. XMRV was originally only reported in a subset of prostate cancer. Being in blood in a greater number of cases of a different condition has significant public health implications. All that was true in 2009 but has not been borne out enough to support Justin’s comment that perhaps the government are trying to cover up an epidemic – they couldn’t be help responsible on the basis of what they are being told by scientists.

            It’s a pity you don’t stop writing when you get to the first major error….

            Referring to your link below (as no-one else will be reading now and we’re right shifting like crazy down there) you have completely misunderstood the abstract. I have pointed out the use of the term acute when applied to leukaemia (where it doesn’t mean quite the same thing as acute applied to other illnesses) which you also seem to have missed.

          • Anonymous Jun 8, 2011

            Responsibility lies with those given that power.  Those who gave it will decide if there are crimes to answer for.  Once again, you are pretending to be a physician.

          • I think you can read my post above (hadn’t read your discussion below your reply to your post) for those different implications. But basically, you can not really blame the government for not preventing an epidemic or for not wanting to solve CFS, after the PC findings. 

            Only after the virus was found in blood, the government needed to take appropriate action. Which is what they did through forming a Blood Working Group (which first and foremost goal was/is to protect the blood supply, not to confirm or refute Lombardi et al.).

          • Anonymous Jun 8, 2011

            Not how the regulators or Senators are likely to look on this, never mind the general public.  ME/CFS appears infectious, as the records state.  To have ignored that may well be a criminal act.  To have found MLV viruses in human cells in the 70s and not follow it up may also be considered a criminal offence.  Furthermore, accidentally creating a virus that is now infecting humans, whether five years ago or 70 years ago, may also be considered a criminal offence.  

          • I know there is a “like” button, but seeing as probably almost nobody will read it thanks to me (guilty as charged) and Gob: thank you for this great contribution. You should at least save it and repost it at a more suitable occasion.

            Hat’s off to you, sir!

          • Anonymous Jun 8, 2011

            RRM, do you also think that “the presence of XMRV was only reported in humans 2 years ago ..” as Lance claims?  As you probably do, can I say how impressive it is that you involved yourself in a discussion when you are not informed as to how the virus was discovered and how.  Most impressive.

          • I can’t say that I am impressed if you really think I didn’t know about the PC findings. If you do, you have serious memory problems as I’ve talked about these findings in previous discussions here.

            When you carefully read back Lance’s post, you’ll understand that he (probably, as I can’t speak for the guy) meant in the blood of humans, as that is really when the clock starts ticking for the government (preventing an epidemic and all).

            But I guess I should just read it again, no? 😉

          • Anonymous Jun 8, 2011

            You do keep leaving out certain data that doesn’t fit your preferred outcome.  That is not how science works.  In science you say what you mean specifically and provide data to back it up.  You don’t accidentally claim to replicate when having done no such thing as some negative studies did.

          • kipper7 Jun 9, 2011

            Thank you for taking the time to contribute something of genuine substance to what, at times, has been an unedifying discussion.

            I only wish you were my ID doc!

          • @2987bf76a5a30b96270654ca2e65d367:disqus   Thank you for your thoughtful reply.  I agree we do not have enough of the clinician’s viewpoint in these debates, so it is much welcomed, especially from someone who obviously cares about his patients. 

            With due respect, I must say you don’t know anything of the socio-political history of the disease.  Again, it must be emphasized that it is absolutely beyond doubt that CDC, NIH, the UK govt and the small cabal of UK psychiatrists led by Weseley and White have been waging an intentional, continuous war on the science and patients for almost 30 years.  I do not blame clinicians that much since you are very busy and must rely on government sources, review articles and texts for information on diseases, rather than reviewing all the raw science yourself.  This is necessary, I understand.  We who have had to throughly review all the science and attendant politics can tell you that these sources are extremely faulty re ME.

            Congress concluded, based on two government reports from 1999 and 2000, that CDC had misappropriated at least $13M from the “CFS” budget from 1996-1999 and ordered the money restored, which it was.  The acting CDC director was fired over this.  The actual misappropriation was around $130M encompassing almost all of the budget from 1985-1999 as detailed in Osler’s Web.

            CDC and NIH have mostly lied about the disease.  There is only $3M in NIH funding, even now.  The UK govt has never spent any money at all on any biomedical studies of ME, last I checked.  And on and on.  

            I think you would get a lot from Dr. Deckoff-Jones’ blog XRx:
            http://treatingxmrv.blogspot.com/

            I am glad to hear that ID docs would be excited to treat ME if it could be cured by anti-virals.  How do we as patients get ID docs to help us shine light on these anti-science travesties and get some real science done?  So far we have gotten almost no help from ID specialists (other than a few researchers and clinicians who study and treat AIDS and ME).  Please, we desperately need real science to be done.  Can you help me interest an AMA virology section or whomever else should theoretically be taking this up? 

            I won’t write anymore since you may not be checking this thread.

          • @2987bf76a5a30b96270654ca2e65d367:disqus I understand your point on neurological and psychiatric illnesses being real.  ME is a neuro-immune disease.  The literature shows clearly that it is not a psychiatric illness.  There is not one bona fide study that points in this direction of which I am aware; all of them point away from psychogenesis.  And of course the immune, neurological and other studies clearly show physical disease.

            You make good points about the evidence favoring XMRV as unrelated to ME.  There is also substantial evidence on the other side.  We don’t know what the answer is yet.

            Can you and the others who have criticized the XMRV- ME association please spend equal energy fighting the much clearer injustice that ME is only funded at $3M per year and NIH has announced it will not increase in 2012.  It would also be nice if you could criticize the clearly fraudulent and/or grossly incompetent science on ME, in addition to this bona fide study.  

            For example:
            http://www.cfsnovel.com/blog/?p=3

        • Lance Jun 8, 2011

          My post below was supposed to be in response to Justin’s comment below. I had some problems posting it (probably cos it’s so damn long & boring….).

          Just saying because its a bit out of context here.

    • http://laikaspoetnik.wordpress.com/2011/06/07/to-retract-or-not-to-retract-thats-the-question/

      The above carries some further insight – perhaps – as to why the Letter was posted and the voluntary retraction asked.

      Though as you can see it remains a contentious issue but not for the reasons you seem to think apply in this case.

  19. Alan Dove is needlessly insulting.  Do you really want him to be an ‘ambassador’ of science on your show?  I guarantee having him on your show will put many people off to science.
    http://alandove.com/content/2011/06/our-cross-to-bear/

  20. Alan Dove is needlessly insulting.  Do you really want him to be an ‘ambassador’ of science on your show?  I guarantee having him on your show will put many people off to science.
    http://alandove.com/content/2011/06/our-cross-to-bear/

    • Sorry I must have missed Mr Dove’s insults on this episode. To what are you referring, or are you generalising and expressing a personal opinion?

  21. ResearchforTreatment Jun 9, 2011

    agree 1000%.  i think VR may have him on the show just to be controversial; kind of like a crazy housewife on one of those reality tv shows….he one who gets  drunk, insults everyone and tips over the banquet table…no knowledge gained from anything he says but some find him entertaining.

    in this last broadcast he actually answered more questions than Goff…how can it be that AD knows more abt RV’s or even me/cfs than goff.   if you notice otoh, rich condit only contributes when he really has something to add that he has knowledge about.  ad spouts out nonsense continually thru the broadcast.

    my fave AD line this week was when he “innocently” correlated cytokine/chemokine markers/levels found in me/cfs pts to those found in obese and/or depressed ppl.  if that line was not meant to piss off and denigrate me/cfs pts, i don’t know what it was for.

    if anything by now, ad should know that me/cfs pts are REALLY sick (like cancer or aids pts)….we’re not obese and or depressed.  (in fact i went down to 80 lbs when i became ill, and prior to the illness was the happiest i had ever been in my life…..great husband, child, friends, home, family, etc.)

    i’ve decided AD is there to stir the shit and raise the hackles of many me/cfs pts and i will either ignore him or just not listen to the show anymore.

    i will listen to lipkin’s podcast, but if ad makes one more disparaging comment abt me/cfs pts then that’s it for me.  sick of listening to someone so ignorant yet so biased abt  me/cfs pontificate abt it.

    • Did AD not actually say that heightened levels of cytokines were to be found in other chronic diseases – he didn’t specifically refer to ‘obese and/or depressed ppl.’ now did he?

      Unless my memory has misled me – which is perfectly possible and understandable even.

      • ResearchforTreatment Jun 10, 2011

        yes jack, he did specifically say: depression and obesity….do u think i would make it up when the podcast is here for all to hear; do u think i’d waste my time criticizing someone unless he was specifically denigrating and dismissive of our disease.  no, i would not.  re-listen to the lovely AD if you question my word.

        and now that VR is on the CAA science advisory board, you really have to scratch your head in wonder over why he would have someone w/AD’s views involved in discussions about a serious bio-physical condition ….things that make you go hmmmmm.

        at a minimum AD should disclose his wife’s work focus re: me/cfs and his own personal beliefs that me/cfs is a somatic condition.

        • Apols you were correct, he did say that in the context of high levels not showing an infective agent, and that they alone provide ‘no useful information’.

          • ResearchforTreatment Jun 11, 2011

            JACK:

            as i said….AD sputtering nonsense he knows nothing abt….how can he say these abnormal levels have no meaning in a very ill me/cfs pts…expert me/cfs drs: klimas, peterson, cheney, etc….all agree that these abnormal cytokine/chemokine levels are meaningful in me/cfs pts….so why does ad throw in the line…. oh those are seen in obese/depressed ppl too…..he says it to insult us and to denigrate our disease as one not worthy of scientific research or interest….a somatic, non-serious condition.

            when a very ill person who has lost 25 pounds in 4 week comes into the dr ‘s office and their cytokine/chemokine test results are abnormal like this…it means they are VERY sick and should not just be instructed to go see a therapist, take anti-depressants, excercise more and/or go on a vacation to de-stress….yes these are the things i was told by several dr’s at top notch medical facilities.  why was i told this?  because american dr’s have not been educated abt the seriousness of the disease…and when a hi-profile scientist from columbia university has a co-host on his show who continually  communicates this type of nonsense, we will never receive proper medical treatment and/or regain our health.

            this is the danger stmts like AD’s (obesese/depressed ppl) create for seriously ill me/cfs pts; and this is why so many of us shudder with displeasure and fear when he speaks so ignorantly about our very serious disease. 

            this is why i use my precious reserves of energy to write criticisms of AD on this board….he  and his beliefs are a danger to us….giving him a platform to spread his uninformed/ignorant beliefs is something all me/cfs pts should worry abt…..especially now that VR is on the CAA Science Advisory Board.

            VR if you’re going to be accepted by the the me/cfs community in your new assoc with CAA you need to clarify where your views of me/cfs stand in comparison to your co-hort AD’s trivialization of the illness!!!!   at this point you are considered guilty of holding the same views (by many me/cfs pts) because of your relationship and joint podcasts w/ a man, AD, who holds and communicates views that trivialize our disease as a somatic one.

  22. ME too Jun 11, 2011

    Over at ‘In the Pipeline’ – June 7, 2011 – ‘Murine Viruses and Chronic Fatigue: Does the Story Continue’, at comment 9, PeterW asks Derek to comment on how common it is for a group of scientists to concertedly campaign, almost insist, that the findings of a research paper are erroneous when subsequent attempts to verify the results are not yet completed (i.e. the results of the Lipkin study).  I recall hearing on ‘TWiV 129: We’ve got mail’ about the scientist whose results could not be replicated until other scientists conducted their research in the same lab, when, lo and behold the results were replicated (and verified).  There was something specific about that lab.  

    It seems, until the Lipkin results are in, something as specific as the above example, i.e. other scientists, or the original scientists, working in the original lab, has not yet taken place.  Wouldn’t it be prudent to wait for the Lipkin results (since the funds for the Lipkin study are already allocated).  To argue, “it’s wasting money on a futile study” (when funds have already been spent) doesn’t seem an apposite argument, and I can’t think why else scientists would object so vehemently to the paper remaining intact for the time being.

    Like PeterW, I’m interested to know if this behaviour is common in private interactions between scientists (i.e. away from the public eye, since most of these types of discussions don’t end up with such high public profile), or is there something about Judy and WPI (and their cultish followers) that’s fired up the other side to an abnormal extreme?

    For example, is ERV’s attitude normal? (i.e. ERV’s reasonably fiery insults towards WPI and its staff on her blog.)

    I’m disillusioned with WPI’s public statements and behaviour (e.g. linking XMRV to autism and other conditions without evidence, marketing an unvalidated test, seems to move the goal posts around their own work in order to explain why others have failed to replicate their findings, pretty much accuses other scientists of incompetence), but does that justify scientists baying for retraction of WPI’s work before Lipkin’s results are in?

    This degree of impatience (baying) contrasts with the civility maintained (most of the time) by commenters here; there are times where I am amazed someone doesn’t lose their temper with Gob!  (I think RRM and Gob are the Roger Federer and Rafael Nadal of this XMRV discussion – long rallies.)

    Why is there such patience (with Gob and others) here, but such impatience to remove that paper from science?

    EXTRA INFO:

    Here is a transcript of the segment I refer to in TWiV 129 (it runs from time 1:01:09 – 1:05:00 on the download):

    DD reads Sophie’s question: “ … with respect to the decline effect and the scientific method.  I think this article is quite disturbing even if the author is right I have serious problems with the sentences like, “If replication is what separates the rigour of science from the squishiness of pseudoscience where do we put all these rigorously validated findings that can no longer be proved, which results should we believe …..”

    (Sophie’s question refers to an earlier TWiV episode, where there was discussion about an article that appeared in New Yorker several months earlier, which was about difficulties of scientific replication especially in fields like behavioral science.)

    TWiV team’s discussion of Sophie’s question:

    DD:  This guy, Judah Folkman, who became world famous for his work on angiogenesis at Harvard was for many years ridiculed behind his back because no one could replicate his results, and yet he was a very honest and straightforward man.  So, what he ended up doing was inviting people to come into his laboratory and work with him to see if they could get the same results that Judah Folkman got at least working in his space and, lo and behold, they did.  So they had something in their own lab that wasn’t quite the same as Judah Folkman’s lab and Judah Folkman openly and willingly invited them in, because he knew that what he had found was correct.  So, just because you don’t get it to work doesn’t mean that the other guy didn’t get it to work.  

    RC: That kind of stuff does happen, you move labs and all of a sudden stuff doesn’t work anymore.

    VR: That’s what they actually talk about in this [New Yorker] article, they talk about an experiment that was set up in five different locations, they used all of the same experimental conditions but they got different results, because every lab is different.  …. 

    AD: The issue is you can’t necessarily control for everything …. 

    MORE ON FOLKMAN:

    Folkman died in 2008:

    http://news.harvard.edu/gazette/story/2008/02/cancer-research-pioneer-judah-folkman-dies-suddenly-at-74/ 

    Cancer research pioneer Judah Folkman, the Andrus Professor of Pediatric Surgery and professor of cell biology at Harvard Medical School (HMS), died on Jan. 14 of a heart attack.  Folkman, who was also the director of the Vascular Biology Program at Children’s Hospital Boston, was 74.

    Folkman had a brilliant, if contentious, career. Nobody believed him when, in the 1960s, he claimed that the growth of cancers could be stopped, even reversed, by blocking the tiny vessels that feed them blood.  Over the years, however, he survived peer rejection of his theory and went on to develop drugs that did what he predicted they would do.

    ………….

    Today, no scientist or physician doubts the existence of angiogenesis or its role in cancer, but in the early 1970s Folkman’s idea was heavily criticized. “Fantasy,” some experts labeled it.

    • Anonymous Jun 11, 2011

      The WPIs assays are validated and there is evidence, that has been presented at conferences, that shows an association of HGRVs to other diseases.  This evidence comes from two labs, the other being the NCI.

      • Guest Jun 11, 2011

        Other retrovirolgoists have asked Mikovits to draw blood from her original Science cohorts. She agreed to their requests. To date, she has refused to provide them with the information after repeated requests. Why has Mikovits broken her agreements with these scientists…hmmmm?

        • Guest Jun 11, 2011

          Actually my reply is @ ME too  NOT Gob987.

          • Anonymous Jun 12, 2011

            People reply to whom ever they want.  There is no reason for Mikovtis/Ruscetti/Silverman to draw blood from their original cohort.   They have done this already, and provide positives for the CDC to retest.  They were negative for contamination and XMRV.  The CDCs assays were not capable of detecting the virus. 

    • It has been reported on the Age of Autism blog a good while ago that Dr. Mikovits presented a paper at an Autism conference showing her experiment where HGRVs were found in the majority of a small sample of autism patients tested.  Trine T. of Chicago Tribune wrote that there was no published evidence of the link in order to try to discredit WPI, without mentioning the unpublished evidence. It is difficult for WPI to publish because of the anti-ME-science bias.  This was then misreported as “no evidence” by the horrendously inaccurate Forbes ‘pseudoscience’ blog.

  23. ResearchforTreatment Jun 12, 2011

    if you really want to understand me/cfs suffering read this article by llewellyn king, a renowned, highly respected journalist rather than listening to AD, ERV and others of their ilk:

    http://www.realclearscience.com/articles/2011/06/02/chronic_fatigue_syndrome_is_misunderstood_106242-comments.html#disqus_thread

  24. Please, to the people on “the forums”, be more critical of your “leaders”:

    http://www.mecfsforums.com/index.php/topic,7857.0.html“How do we know that the patient that was used to create the 22Rv1 cell line was infected with XMRV?The Coffin paper from Science last weeks shows that he was infect!!!”No, it does not show that at all. It’s totally false, actually. There were env sequences present because that region of preXMRV-1 is identical to XMRV. The “XMRV-specific” env assay detected preXMRV-1 (which is why no XMRV gag sequences were detected).It’s very simple, really

    • Here one can view preXMRV-1 (blank means identical to XMRV). From supplemental figure Figure S2 (see the supporting online material from Paprotka et. al), one can clearly see that the env sequences that were detected were from the regions that were identical to XMRV. Please check primers 8f, 8r and 8rsa.

      Nice try though, G&V&C…..

      • Anonymous Jun 12, 2011

        That image shows the preXMRV1 to be only 91% match for XMRV in part of the ENV region. What image are you looking at?

        • Anonymous Jun 12, 2011

          Here is the region you should be focussing on.

          • No, Gob. If you look at what regions the env primers targeted, you should understand that you are wrong.

            See the attached image. Note how the env primers that were positive for preXMRV-1 AND XMRV targeted the region BEFORE nucleotide position 7097. Check the 8r, 8f and 8fsa primers (and note that the G3r primer is not positive for XMRV env). Moreover, the authors specifically state that they have used primer 8r for XMRV env detection (see the heading “Quantitative real‐time PCR assay for XMRV env detection” in the SOM).

            Therefore, it is pretty much stupid to assume that the authors used XMRV env primers that were targeted for that non-identical region between 7097 and 7693, and thus “prove” that XMRV and not preXMRV-1 was being detected, as you/v99/Gerwyn seem to do.

          • Anonymous Jun 13, 2011

            G3r is blue and is thus not intended to identify XMRV.

            At least you are starting to understand PCR and that primers are of importance.  The authors also provide the following to educate you.  “The specificity of the PCR reactions may be altered if the primers are used in different combinations.” How many negative papers have ignored the scientific method?

          • “G3r is blue”. LOL. Has nothing to do with what I said, Gob. I merely specified that primer G3r was negative for XMRV because that primer was in the 7097-7693 region.

            But you are focusing on a minor issue. I argued that v99 and Gerwyn are pretty ignorant because it’s obvious that the used env primer sets were not targetting the env region between nucleotide position 7097-7693. 
            (And none of the negative papers thus far has not adhered to the scientific method, Gob. Because they didn’t do the experiment(s) that you would like to have seen, doesn’t make it so. You know what is considered “unscientific”? Changing the subject and asking random questions if you don’t like the topic at hand.)

          • Anonymous Jun 13, 2011

            “Supplemental Fig. S2:  (…) primers used for PreXMRV‐1‐specific amplification are blue,”

            They clearly state XMRV env, not PreXMRV-1 or PreXMRV-2.

            “We used the same XMRV-specific primer sets to amplify and sequence DNA from early passage xenografts (736, 777, 8L, 8R, 16R, and 18R; Fig. 2B); the results showed that XMRV env, but not gag sequences were present (sequencing coverage summarized in fig. S3),”

            As Paprotka et al states, “The specificity of the PCR reactions may be altered if the primers are used in different combinations.”  Why have the negative papers altered the variables?  RRM, can you name the variables used in PCR ?

          • The paper should be retracted? LOL, yur funny. 

            The authors found out that primer was targetting another virus (preXMRV-1) because they couldn’t detect XMRV gag.  That is why they made this primer blue and that is why you think it was not used in that experiment. You are seriously reasoning in circles, dude.

            I suggest the poster retracts that stupid forum post… 😉

          • Anonymous Jun 13, 2011

            Paprotka et al. detected XMRV env sequences in the earlier xenografts.  The conclusions in Paprotka et al are incorrect.  

            If you wish to pretend that the primers intended target was altered, please quote where this is stated in the paper?  They only say that those in blue are “PreXMRV‐1‐specific” and if you understood PCR you would know they would never be capable of detecting XMRV.

          • Unlike you, Gob, I am willing to back my assertions with data. From the SOM:

            “Quantitative real‐time PCR assay for XMRV env detection. To specifically quantify XMRV env sequences, primers 3f (5’CTTTCCCTAAACTATATTTTGACTTGTGTG‐3’; 600 nM finalconcentration) and 8r (5’‐CTGGATGCTACCGGAGCCC‐3’; 800 nM final concentration)”

            You can clearly see that they used primer 8r for XMRV env detection.

            Furhermore, any sane logical reading of the paper will get you to my conclusion. When the writers write about those “XMRV-specific” primers, they had not yet found preXMRV-1. They found preXMRV-1 using primers that they thought were specific for XMRV. This sentence, just before the passage you misread, really clarifies it all:

            “Next, we developed several primer sets to specifically amplify XMRV sequences and excludeendogenous murine retroviruses”

            It’s just the normal, chronological way scientists describe their experiments, although I will agree it would be nice if they had formulated it better (like “primers that we thought were specific for XMRV”). 

          • Anonymous Jun 13, 2011

            Thank you.  As I correctly stated, they did not use G3r primers for XMRV.  

            G3r and 8r are different primers.  

            The G3r primers were never designed for XMRV and no where does anyone state that they are.

          • What are you mumbling bout G3r? I never stated that G3r was used – I merely pointed out (because G3r was “accidentally” also present in the red square that I drawed for clarification) how G3r should be disregarded for the purpose of this discussion. If you look back at my first post, you see that I didn’t even mention the G3r primer.

            Frankly, you really seem to be lacking essential grammatical and cognitive capabilities.

          • Anonymous Jun 13, 2011

            It is your third post where you began the G3r obsession. You claimed, “(and note that the G3r primer is not positive for XMRV env).”  Why would it be positive if it is not specific for XMRV?  Try and pay attention. Or should people now copy your posts before you alter them?

            Summary: XMRV was detected in the early xenografts.  The conclusions of the paper are unsound and the paper should be retracted.  

            Nice and neat is it not?

          • Note it was between parantheses, usually a sign to say it’s additional information. and when you first addressed it, I literally specified that it was a “minor issue”, Gob. You are again diverging away from the issue at hand.

            What’s important is that all those other three primers did not target the non-identical region your argument hinges on. To be really clear:

            NONE OF THE PRIMERS IN THE ENV REGION WERE (JUST) XMRV SPECIFIC

            Therefore it is patently stupid to conclude that they conclusively detected XMRV using ONLY env primers, Gob. You cannot conclusively detect something if your primers are not specific.

            And you are very welcome to copy my posts for future reference. I am not even aware of the fact that I could alter them.

          • Anonymous Jun 13, 2011

            What is important is that Paprotka et al detected XMRV in the earlier xenografts.

            If they had wanted to give their belief any validity they would have used XMRV specific primers and in fact state:

            “We used the same XMRV-specific primer sets to amplify and sequence DNA from early passage xenografts (736, 777, 8L, 8R, 16R, and 18R; Fig. 2B); the results showed that XMRV env, but not gag sequences were present (sequencing coverage summarized in fig. S3),”

          • Yes, they attempted to find XMRV, but because only their env primers would return positives, they (unlike you) started thinking what the reason for that may be. The reason was the presence of preXMRV-1, WHICH IS IDENTICAL TO XMRV IN THE ENV REGIONS THAT THOSE PRIMERS TARGETED.

            Paprotka did check for XMRV in the earleir xenografts, because they targeted these xenografts with more than just env primers. While the env primers weren’t specific for XMRV (and therefore only idiots think that you can specifically detect XMRV using such a primer), the assays combined ARE specific for the detection XMRV.

          • Anonymous Jun 13, 2011

            Where is the proof it was PreXMRV-1 and not XMRV?

            They say the primers used were, “XMRV-specific primer sets”.  

            You have now claimed that those who say the primers were specific are idiots.  Paprotka et al did say that.

          • Like I have explained, Paprotka said it in another context. They were merely reporting this at the time when they thought the env primers were specific for XMRV. As you can clearly see from the now infamous red square picture, they are not.

            And the proof is in the fact that the other primers that were targeted for XMRV (and didn’t target preXMRV-1) did not detect the thing. I know what you are going to say, Gob, but remember (the wisest thing I have seen you write here) that science is not absolute. Regardless, it still makes the conclusion on the forums incredibly stupid: “He was infect!” 

          • Anonymous Jun 13, 2011

            In the paper they state:

            “We used the same XMRV-specific primer sets to amplify and sequence DNA from early passage xenografts (736, 777, 8L, 8R, 16R, and 18R; Fig. 2B); the results showed that XMRV env, but not gag sequences were present (sequencing coverage summarized in fig. S3),”

            They clearly show they detected XMRV env, not PreXMRV-1 or 2.   

            Are you now claiming that Paprotka et al should not have said this?

          • It’s no problem to me, as I understand what they are saying.

          • Anonymous Jun 13, 2011

            Pick one then?  Are the primers XMRV env specific and found the virus in the earlier xenografts, or were they not specific and should have been, as you say it is stupid if they are not?

          • Anonymous Jun 13, 2011

            RRM Post

            “It’s no problem to me, as I understand what they are saying.”

          • Anonymous Jun 13, 2011

            RRM post

            Like I have explained, Paprotka said it in another context. They were merely reporting this at the time when they thought the env primers were specific for XMRV. As you can clearly see from the now infamous red square picture, they are not.

            And the proof is in the fact that the other primers that were targeted for XMRV (and didn’t target preXMRV-1) did not detect the thing. I know what you are going to say, Gob, but remember (the wisest thing I have seen you write here) that science is not absolute. Regardless, it still makes the conclusion on the forums incredibly stupid: “He was infect!”

          • “You have also claimed that it is not enough to use none [sic] specific primers to look for XMRV.”
            I wouldn’t call it a claim; it’s undisputable logic. Suppose I have a method that detects apples and oranges. I can NEVER specifically detect apples with just that assay (or oranges, but let’s keep it simple). Only when (for instance) I have another assay that detects (a portion of)  an orange and it returns a negative result, I can conclude that I have detected an apple.
            That is exactly why none of those three env primers from Paprotka et al. can differentiate XMRV from preXMRV-1. Yes, there is a sentence in the paper that implies otherwise (in the eyes of dumb people), but  please at least say you understand this very basic logic.

          • Anonymous Jun 13, 2011

            RRM post

            “Yes, they attempted to find XMRV, but because only their env primers would return positives, they (unlike you) started thinking what the reason for that may be. The reason was the presence of preXMRV-1, WHICH IS IDENTICAL TO XMRV IN THE ENV REGIONS THAT THOSE PRIMERS TARGETED.
            Paprotka did check for XMRV in the earleir xenografts, because they targeted these xenografts with more than just env primers. While the env primers weren’t specific for XMRV (and therefore only idiots think that you can specifically detect XMRV using such a primer), the assays combined ARE specific for the detection XMRV.”

          • Anonymous Jun 13, 2011

            RRM post

            “Note it was between parantheses, usually a sign to say it’s additional information. and when you first addressed it, I literally specified that it was a “minor issue”, Gob. You are again diverging away from the issue at hand.What’s important is that all those other three primers did not target the non-identical region your argument hinges on. To be really clear:NONE OF THE PRIMERS IN THE ENV REGION WERE (JUST) XMRV SPECIFICTherefore it is patently stupid to conclude that they conclusively detected XMRV using ONLY env primers, Gob. You cannot conclusively detect something if your primers are not specific.And you are very welcome to copy my posts for future reference. I am not even aware of the fact that I could alter them.”

          • I have never altered any post here, Gob. It must be your memory. Or a vast CONSPIRACY!!!

          • Anonymous Jun 13, 2011

            You have altered your posts.  

          • Whatever makes you reduce all that cognitive dissonance, Gobster.

          • Anonymous Jun 13, 2011

            That is a good idea, retract Paprotka et al.

          • Tiggerkenwood Jun 15, 2011

            If you think someone is constantly altering posts here, why not keep a copy of the original post for proof ?

          • Anonymous Jun 15, 2011

            That is what I am doing now I know they are.

          • Anonymous Jun 13, 2011

            RRM post:

            “I have never altered any post here, Gob. It must be your memory. Or a vast CONSPIRACY!!!”

          • Anonymous Jun 13, 2011

            RRM post

            “What are you mumbling bout G3r? I never stated that G3r was used – I merely pointed out (because G3r was “accidentally” also present in the red square that I drawed for clarification) how G3r should be disregarded for the purpose of this discussion. If you look back at my first post, you see that I didn’t even mention the G3r primer.
            Frankly, you really seem to be lacking essential grammatical and cognitive capabilities.”

          • Anonymous Jun 13, 2011

            Here is the text that shows those in blue are specific to PreXMRV-1, not XMRV.

            “primers used for PreXMRV‐1‐specific amplification are blue,”

          • Anonymous Jun 13, 2011

            RRM post

            “Unlike you, Gob, I am willing to back my assertions with data. From the SOM:
            “Quantitative real‐time PCR assay for XMRV env detection. To specifically quantify XMRV env sequences, primers 3f (5’CTTTCCCTAAACTATATTTTGACTTGTGTG‐3’; 600 nM finalconcentration) and 8r (5’‐CTGGATGCTACCGGAGCCC‐3’; 800 nM final concentration)”You can clearly see that they used primer 8r for XMRV env detection.Furhermore, any sane logical reading of the paper will get you to my conclusion. When the writers write about those “XMRV-specific” primers, they had not yet found preXMRV-1. They found preXMRV-1 using primers that they thought were specific for XMRV. This sentence, just before the passage you misread, really clarifies it all:”Next, we developed several primer sets to specifically amplify XMRV sequences and excludeendogenous murine retroviruses”It’s just the normal, chronological way scientists describe their experiments, although I will agree it would be nice if they had formulated it better (like “primers that we thought were specific for XMRV”).”

          • Anonymous Jun 13, 2011

            RRM post 

            “The paper should be retracted? LOL, yur funny. 
            The authors found out that primer was targetting another virus (preXMRV-1) because they couldn’t detect XMRV gag.  That is why they made this primer blue and that is why you think it was not used in that experiment. You are seriously reasoning in circles, dude.I suggest the poster retracts that stupid forum post… ;-)”

          • Anonymous Jun 13, 2011

            You have also altered this post since I replied.

          • I understand how you’d like to think that but no, I have not.

          • Anonymous Jun 13, 2011

            You have altered this post since I replied.

          • No sir, I have not.

      • Anonymous Jun 13, 2011

        You altered this post since I replied.  Backtracking?

        Paprotka et al detect XMRV in the earlier xenografts.  The origin of the XMRV variant of HGRVs has not been found.

        • I have not altered a single letter, Gob. I am not even aware of the fact that I can alter posts here.

          The fact that you conclude this however, says a lot about your ability to objectively and critically evaluate relevant data.

          • Anonymous Jun 13, 2011

            RRM Post

            “I have not altered a single letter, Gob. I am not even aware of the fact that I can alter posts here.
            The fact that you conclude this however, says a lot about your ability to objectively and critically evaluate relevant data.”

  25. Tiggerkenwood Jun 15, 2011

    Why doesn’t someone take some tissue from the cervix, stomach, or prostate of a few of the people who tested positive under the VIPdx antibody test and look for XMRV.  We could end this now!   Like many women, I have had a biopsy of my cervix before.  It is easy, quick and painless.  We could start with cervix biopsies or only do those.  

     All this back and forth bickering by everyone (including the cfs’ers, doctors, scientists, and radom people) is getting us nowhere.  It is all so very frustating.

    • Anonymous Jun 15, 2011

      Why don’t they replicate?  

      The people on this podcast are all aware of what that means. You can use the same variables.

      To shine a light on Shin et al., as a way to conduct research and not get contamination, when they had contamination, is laughable.

Content on this site is licensed by Microbe TV, LLC under a Creative Commons Attribution 3.0 License